ID: 1200111926

View in Genome Browser
Species Human (GRCh38)
Location X:153744784-153744806
Sequence CTGTGGGTCTCGAGGAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 212}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200111921_1200111926 -1 Left 1200111921 X:153744762-153744784 CCTCAGAGCCTGGTGGTGTCTGC 0: 1
1: 6
2: 2
3: 37
4: 351
Right 1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG 0: 1
1: 0
2: 3
3: 22
4: 212
1200111919_1200111926 4 Left 1200111919 X:153744757-153744779 CCCTGCCTCAGAGCCTGGTGGTG 0: 1
1: 5
2: 5
3: 29
4: 300
Right 1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG 0: 1
1: 0
2: 3
3: 22
4: 212
1200111920_1200111926 3 Left 1200111920 X:153744758-153744780 CCTGCCTCAGAGCCTGGTGGTGT 0: 1
1: 5
2: 1
3: 26
4: 259
Right 1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG 0: 1
1: 0
2: 3
3: 22
4: 212
1200111914_1200111926 28 Left 1200111914 X:153744733-153744755 CCACTGGCAAATGCAGTCCTTCC 0: 1
1: 7
2: 2
3: 16
4: 197
Right 1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG 0: 1
1: 0
2: 3
3: 22
4: 212
1200111915_1200111926 11 Left 1200111915 X:153744750-153744772 CCTTCCTCCCTGCCTCAGAGCCT 0: 1
1: 5
2: 16
3: 93
4: 1159
Right 1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG 0: 1
1: 0
2: 3
3: 22
4: 212
1200111917_1200111926 7 Left 1200111917 X:153744754-153744776 CCTCCCTGCCTCAGAGCCTGGTG 0: 1
1: 5
2: 5
3: 51
4: 552
Right 1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG 0: 1
1: 0
2: 3
3: 22
4: 212
1200111924_1200111926 -9 Left 1200111924 X:153744770-153744792 CCTGGTGGTGTCTGCTGTGGGTC 0: 1
1: 0
2: 5
3: 14
4: 242
Right 1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG 0: 1
1: 0
2: 3
3: 22
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200111926 Original CRISPR CTGTGGGTCTCGAGGAGAGA TGG Intergenic
900093648 1:931439-931461 TTGTGGGTCTCTAGGAGGGTGGG - Intronic
900391117 1:2434371-2434393 CTGTGGGTGCCCGGGAGAGAAGG - Intronic
901318547 1:8324794-8324816 CTGAGGGTCCTGAGGGGAGAAGG + Intronic
901927060 1:12573022-12573044 CTGTGTGCCTGGAGGAGTGAGGG - Intronic
902391499 1:16109692-16109714 CTCTGGGTCTGGAGGAGGGCAGG + Intergenic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
903664958 1:25000671-25000693 CTTTGGCTCTCGAGGGCAGAGGG + Intergenic
904205984 1:28855541-28855563 CTGTGGGTGGAGGGGAGAGAGGG + Intronic
905474914 1:38219284-38219306 CTGTGGGGCTTCAGGGGAGAGGG + Intergenic
905580947 1:39082160-39082182 CTGTGAGTCTCGGGGATTGATGG + Intronic
907071003 1:51534826-51534848 CCCTGGGTCCAGAGGAGAGAAGG - Intergenic
907661460 1:56396593-56396615 CTGTTGGTGTGTAGGAGAGAAGG - Intergenic
912935871 1:114003234-114003256 CTGTGGGTCTGGGGCAGGGAAGG + Intergenic
915571931 1:156749599-156749621 CTTTGGGCCTCCAGGACAGAAGG - Intronic
915768460 1:158391984-158392006 CTGTGGTTCTAATGGAGAGATGG + Intergenic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924304092 1:242669324-242669346 TTGTAGGTCTCCAGGACAGATGG - Intergenic
924309738 1:242727971-242727993 CTGGGGGTGTCAAGGAGAGTGGG - Intergenic
1063039049 10:2318060-2318082 CTGTGAGTCGCTTGGAGAGAAGG + Intergenic
1063251813 10:4282178-4282200 CTGTGAGTGTCGAGGTGAGTCGG - Intergenic
1064705552 10:18069431-18069453 CTGTGGGTCTCCAGGCTTGAGGG - Intergenic
1065386806 10:25142254-25142276 CTCTCGGTCCCGAGCAGAGATGG + Intergenic
1065493079 10:26302330-26302352 CTTTGGATCTCGATGGGAGATGG - Exonic
1066746283 10:38605631-38605653 CTGCGGGTCTTGGGGAGAGATGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067694963 10:48528049-48528071 CTGTGGGTCTCCCAGAGAAATGG - Intronic
1068170895 10:53393224-53393246 CTCTGCTTCTTGAGGAGAGAGGG + Intergenic
1069853299 10:71424511-71424533 GTGGGGGTATCGAGGAGACAGGG - Intronic
1070773437 10:79096149-79096171 GGGTGGGTCTGGAGGAGAGGGGG + Intronic
1071786439 10:88905565-88905587 CTTTAGGTCTGGAGTAGAGATGG + Exonic
1072659703 10:97356259-97356281 TTGTTGGTCTGGAGCAGAGAAGG - Intergenic
1073618864 10:105026266-105026288 CTGTGGCTGTCCAGGGGAGAGGG - Intronic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1074921751 10:118021415-118021437 CAGCAGGTCTCTAGGAGAGAGGG - Intronic
1076385741 10:130053846-130053868 CTGTGGGTCCCTGGGAGAGTGGG + Intergenic
1076830528 10:132992199-132992221 CTGTGAGCCTCGAGGACAGAGGG + Intergenic
1077340185 11:2022971-2022993 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1079591981 11:22192837-22192859 CGGCGGGTCCCGAGGAGGGACGG + Intergenic
1080339324 11:31241541-31241563 CTTTGGGTCTCTAAGGGAGAAGG - Intronic
1082751472 11:57022802-57022824 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
1082801271 11:57416531-57416553 GCTTGGGTCTGGAGGAGAGATGG + Intronic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083475338 11:62911634-62911656 CTGTACGTCTCTAGGAGAAAGGG + Intronic
1083998855 11:66285164-66285186 CTGCGAGTCTTGGGGAGAGAAGG - Intronic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1085258531 11:75191012-75191034 CTGTGGATGCTGAGGAGAGATGG + Intronic
1085638399 11:78175659-78175681 CTGTGGGCCTTGAAGATAGATGG - Intronic
1085771088 11:79326478-79326500 CTGTGGGTCTTTAGGCGAGGGGG - Intronic
1089896563 11:121935851-121935873 CTATGGGTCTCAGGGAGAGCAGG + Intergenic
1090540772 11:127700624-127700646 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
1090705118 11:129329308-129329330 CTGGAGCTCTGGAGGAGAGATGG - Intergenic
1202823170 11_KI270721v1_random:78160-78182 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1095326651 12:40903128-40903150 CTGTGGGTCTCCATGACTGATGG - Intronic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097195151 12:57238984-57239006 GTGTGGGGAGCGAGGAGAGATGG - Intronic
1097259688 12:57711121-57711143 CTGTGGGGCTGGAGCAGGGATGG - Intronic
1097528820 12:60772893-60772915 CTGTGGGGGTTGAGGAGGGAAGG + Intergenic
1099738639 12:86601833-86601855 CTGTGGGCGACAAGGAGAGAAGG + Intronic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1103328490 12:120137569-120137591 CTGTGGTTCTGGAGGAGAGCTGG - Exonic
1103987632 12:124778293-124778315 CTGTGGGCCACGTGGAGAGAAGG + Exonic
1104035491 12:125094515-125094537 CTGTGGCTCTGCAGCAGAGAGGG - Intronic
1104477610 12:129083550-129083572 CTGTGGGTCTCAGGGACAGTTGG - Intronic
1104884024 12:132094385-132094407 CTGTGGCTCTCGGAGAGAGGGGG + Intronic
1105277937 13:18947113-18947135 CAGTGGGTGTGGAGCAGAGAGGG + Intergenic
1109747696 13:66647926-66647948 CTGTGGGCCTGGGGAAGAGACGG + Intronic
1110735133 13:78927770-78927792 CTGTGGGTCTTGGGCAGATAGGG - Intergenic
1112176409 13:97029781-97029803 CTGTGACTCTCTAGGAGGGAAGG - Intergenic
1112589641 13:100751343-100751365 CTGGGGGCTTTGAGGAGAGAAGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1115442625 14:33453762-33453784 CTGTGGGTCTCCAGGTAAGGAGG - Intronic
1115904290 14:38189781-38189803 TTGGGGGTCCCAAGGAGAGAGGG - Intergenic
1117990584 14:61429118-61429140 CTGTTGGTCTGGAGAATAGAAGG + Intronic
1118638210 14:67767419-67767441 CTGGGGGTCGTGAGGAGAGTGGG - Intronic
1119322930 14:73742282-73742304 CTGTGGCTCACAAGGAGACAGGG - Intronic
1119432231 14:74575916-74575938 CTGTGGGTTTGGAAGAGGGAGGG - Intronic
1119851695 14:77870948-77870970 CTCTGGGTCACGAGGAGACAGGG - Intronic
1122852306 14:104543144-104543166 CTTTGGGCCACGAGGAGAGGAGG + Intronic
1122904771 14:104796550-104796572 CTGTGAGTGTCCAGGAGAAAGGG - Intergenic
1124685898 15:31781698-31781720 TTGTGTGGCTCGAGCAGAGATGG - Intronic
1127974231 15:63985390-63985412 CTCTGGGCCTCGAGGACAGCGGG + Intronic
1128468600 15:67933268-67933290 CTGAGGGTTTTCAGGAGAGAAGG - Intergenic
1128556936 15:68638182-68638204 CTGAGGGTCAGGAGGAGGGAGGG - Intronic
1129150445 15:73684681-73684703 CTGTGGGGCCCGCGGAGAGCTGG + Intronic
1131371537 15:91885954-91885976 CAGTGTGTCTCTAGCAGAGAGGG + Intronic
1132413642 15:101604748-101604770 ATGTGGGTCTGGAAGAGAGCTGG - Intergenic
1132670078 16:1098931-1098953 CTGTGGGGCTGGAGCAGACACGG + Intergenic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1135496604 16:22956912-22956934 CTGTGGCTCCTGGGGAGAGAGGG + Intergenic
1135705509 16:24671305-24671327 CTTAAGGTCTCCAGGAGAGAGGG + Intergenic
1136371179 16:29837030-29837052 ACGTGCGTCTGGAGGAGAGAAGG - Intronic
1136736778 16:32474011-32474033 CTGCGGGTCTTGGGGTGAGATGG - Intergenic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1203016290 16_KI270728v1_random:355566-355588 CTGCGGGTCTTGGGGTGAGATGG + Intergenic
1203034625 16_KI270728v1_random:628724-628746 CTGCGGGTCTTGGGGTGAGATGG + Intergenic
1142555530 17:774168-774190 GTGTGGGACTCGTGGAGAGATGG - Intronic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG + Intergenic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1147193024 17:38748210-38748232 CGGTGGGTCTCGGGGAGGGGGGG + Exonic
1151679346 17:75615391-75615413 CTCTGGGACTGGAGGAGGGAGGG + Intergenic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1157434635 18:47658091-47658113 CTGAGGGTGTCAAGGAGGGAGGG - Intergenic
1157922554 18:51728218-51728240 CTGCTGGTCTGGAAGAGAGAAGG + Intergenic
1160697819 19:493212-493234 CTGAGGGTCGCAAGGAGAGTGGG - Intronic
1161032668 19:2065440-2065462 GTGTGGGTGTCGGGGAGTGACGG + Intergenic
1163126544 19:15247272-15247294 CTGTGGGTCCTGAGGAGGGGCGG - Intronic
1166487820 19:43228843-43228865 CTGTGGGTCACAATGAAAGAAGG - Intronic
1166543795 19:43622625-43622647 CGGGGGGCCTGGAGGAGAGATGG + Exonic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1168187425 19:54709023-54709045 CTGTGGGCTCCTAGGAGAGAAGG - Intergenic
1168233539 19:55047877-55047899 CTGTGGGTTGGGAGGAGTGAGGG + Intronic
926304651 2:11629110-11629132 CTGTGGGTCTAGAAGAGCCATGG + Intronic
927029440 2:19105078-19105100 CTCTGGGTCCTGAGGAGACAGGG - Intergenic
927392955 2:22616207-22616229 CTGTCGGTCGACAGGAGAGAGGG - Intergenic
928370712 2:30738285-30738307 CTGGAGGTCCTGAGGAGAGAAGG + Exonic
928821841 2:35371039-35371061 ATGTGTGTCTGGAGGAGGGATGG + Intergenic
929594857 2:43169668-43169690 CTGGGGGGCTCCAGGAGATAGGG + Intergenic
929727169 2:44442242-44442264 CTGTGGCTCTAGTGGAGAGCAGG + Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
934187922 2:89763129-89763151 CTGCAGGTCTTGGGGAGAGATGG - Intergenic
934308684 2:91844819-91844841 CTGCGGGTCTTGGGGAGAGATGG + Intergenic
934563317 2:95324102-95324124 CTGTGGGGAATGAGGAGAGATGG + Intronic
935639239 2:105275072-105275094 TTGTGGGCCTGGAGGAGGGAGGG - Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937835754 2:126468939-126468961 CTGTGTGTCCTGAGAAGAGAGGG - Intergenic
941070114 2:160945979-160946001 CTGTGGGTTTGGAAGAGACATGG + Intergenic
946051919 2:216869931-216869953 CTGTGGGGCTCTAGGGGATAGGG + Intergenic
946338636 2:219054953-219054975 CTCAAGGTCTCTAGGAGAGAGGG + Exonic
947841189 2:233208852-233208874 CTGTGGGTTCCCAGGAGATACGG + Intergenic
948053571 2:234995574-234995596 CTGTGGGCTTCGAGGACAGGAGG - Intronic
948197250 2:236105080-236105102 CTGTCTGTCTCGGTGAGAGAAGG + Intronic
948582523 2:238997733-238997755 CTGTGGCTCCCGAGAACAGATGG + Intergenic
948900313 2:240953476-240953498 CTGTGGGTCCAGGGGAGGGAGGG - Intronic
1172739235 20:37152467-37152489 CGGAGGGTCTTGAGCAGAGAAGG + Intronic
1173626439 20:44476170-44476192 CTCGGGGGCTCTAGGAGAGATGG + Intronic
1175883556 20:62274534-62274556 CTGTGGTTCTGAAGGAGGGAGGG + Intronic
1176117625 20:63439944-63439966 CTCTGGTTCTCGATGTGAGATGG - Intronic
1176143268 20:63554255-63554277 CTGGGGGTCTCGAGAAGGTAAGG + Exonic
1176210019 20:63915058-63915080 CTGTGGGTCCCAGGGAGAGACGG + Intronic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1179707180 21:43188333-43188355 CTGAGGGTGGCGAGGAGTGAGGG - Intergenic
1180535770 22:16391906-16391928 CTGCGGGTCTTAGGGAGAGATGG + Intergenic
1180871424 22:19149273-19149295 CGGTGGGTCTGGACGCGAGATGG + Intronic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1181866139 22:25857004-25857026 CTGGGTGTCTAGAGGAGACAGGG - Intronic
1185061224 22:48607880-48607902 CTGGGGGTCCTGAGGAGTGAGGG + Intronic
1185333269 22:50261021-50261043 CCGTGGGTCCCCAGGGGAGAAGG - Intronic
951532702 3:23712651-23712673 CTGTGTGAGTCGAGGAGAGATGG + Intergenic
951532746 3:23713037-23713059 CTGTGGGGGTTGGGGAGAGAAGG - Intergenic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
953486499 3:43302574-43302596 CTGGGGATATTGAGGAGAGAAGG + Intronic
953577240 3:44122807-44122829 CCGGGGTTCTCAAGGAGAGACGG + Intergenic
955767985 3:62364943-62364965 CTATGGGTCTAGAAGAGAGGGGG + Intergenic
955943630 3:64170123-64170145 ATGTGGGTCTCCAGGAGAAAAGG - Intronic
956591506 3:70920223-70920245 CTGTGGGCCTCAAAGACAGATGG + Intergenic
956857256 3:73287308-73287330 TTGTGGGGCTGGAGGAGAGGAGG + Intergenic
961673074 3:128548944-128548966 CTGTGGGTGTCAAGGAAGGAGGG - Intergenic
963565777 3:146928484-146928506 CTGTGGTTCTTGAGCAGAGCAGG + Intergenic
967676513 3:192305518-192305540 GTGTGTGTCTGGAAGAGAGACGG - Intronic
968528732 4:1078671-1078693 CTGTTGGTGTCAAGGAGAAAGGG - Intronic
968698622 4:2044319-2044341 CAGAGGGTCCCGGGGAGAGAGGG + Intergenic
968898620 4:3419974-3419996 CTCTGGGGCCTGAGGAGAGAGGG - Intronic
970065251 4:12086328-12086350 CTGTGGCTCTACAAGAGAGAAGG - Intergenic
970272887 4:14366245-14366267 ACGTGGGTCTCAAGGAGAAATGG + Intergenic
971968471 4:33592789-33592811 CTGTGTGTCTCCTGGAAAGATGG - Intergenic
973133390 4:46676142-46676164 CTGTGGGACAAGAGGAGAAATGG - Intergenic
973758227 4:54095356-54095378 CTGTGGGTCAAGATGAAAGAGGG - Intronic
977823679 4:101504914-101504936 CTTTGGGTTTAGGGGAGAGATGG + Intronic
982955708 4:161763528-161763550 CTATGGGTGTAGGGGAGAGAAGG + Intronic
985138357 4:186812335-186812357 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
985888366 5:2697442-2697464 GTGTGGCTCCCGAGGAAAGAAGG - Intergenic
985957686 5:3276996-3277018 CTGAGGGTGCCGAGGAGACAAGG + Intergenic
986289206 5:6385312-6385334 CTGCTGGTCTTGAGCAGAGAAGG - Intergenic
987815929 5:22901275-22901297 TTGTGGGTGACTAGGAGAGAAGG - Intergenic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
996228762 5:121034524-121034546 CTCTGGGTCTCTAGGAAAGATGG + Intergenic
998179237 5:139924944-139924966 GTGGGGATCTCGAGAAGAGATGG + Intronic
998951582 5:147397901-147397923 CTGAAGGTCTCAAGGAGAGAAGG - Intronic
1001435543 5:171696412-171696434 CTGTGGGTCTCTCCGAGATAGGG - Intergenic
1002435604 5:179229069-179229091 CTGAGGGTCTGACGGAGAGAGGG - Intronic
1003317329 6:5024466-5024488 CAGAGGCTCTGGAGGAGAGAGGG + Intergenic
1004164016 6:13239825-13239847 CTGTGTGTCAGGAGGAGAGGAGG + Intronic
1004410327 6:15375576-15375598 CTGTGGGTCTCCAGCAGAGAGGG + Intronic
1005695268 6:28345997-28346019 ATGTGGGTCTCTAGGAGTGAGGG - Intronic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1009027361 6:58016047-58016069 ATGAGGGTCTTCAGGAGAGAAGG - Intergenic
1009439544 6:63660935-63660957 CTGTGGAACTTGAGGAGACAGGG + Intronic
1013045531 6:106481539-106481561 CAGAGGGTCTCCAGGAGAGAAGG - Intergenic
1013295474 6:108754710-108754732 CTGGGGCTCTCTAAGAGAGAAGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1017872640 6:158500163-158500185 CTGTGGTTCTCAATGAGAGGAGG + Intronic
1019224699 6:170500307-170500329 ATGAGGGTCCCGATGAGAGAGGG + Intergenic
1019428727 7:988882-988904 CTGTGGGGTGGGAGGAGAGAGGG - Exonic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022530130 7:31061744-31061766 CTGTGGGAGGCAAGGAGAGAGGG + Intronic
1025008506 7:55375745-55375767 CTCAGGGCCTCCAGGAGAGAAGG - Intronic
1026930330 7:74220086-74220108 CTCTGGGACTCGGGGAGGGAGGG - Intronic
1027430850 7:78111059-78111081 CTTTAGGTCTGGGGGAGAGATGG + Intronic
1028931179 7:96414791-96414813 GTGTGGGTGTCAAGGTGAGAGGG + Intergenic
1029203733 7:98855904-98855926 CTGTGGGGCTCCAGAAGACAGGG + Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1033551232 7:142450248-142450270 GTGAGGGACTCGGGGAGAGAGGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034309140 7:150071647-150071669 CTGTGGGCCTCGAGGACAGAGGG + Intergenic
1034797715 7:154028989-154029011 CTGTGGGCCTCGAGGACAGAGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1039439205 8:37583284-37583306 GTGTGGGTCGGGGGGAGAGATGG - Intergenic
1039550424 8:38439382-38439404 GTGAGGGGCTCGAGAAGAGAAGG - Intronic
1042984323 8:74566404-74566426 CTGTGGGTCTCCAGGCTCGAGGG - Intergenic
1048337322 8:133512707-133512729 CTGAGGGTCGGGAGGAGACAGGG + Intronic
1049274299 8:141711992-141712014 CTGTGGGTCTCGAGGTGATGGGG + Intergenic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1185738556 X:2512042-2512064 CTGTGGGTTTCCAGGCGTGAGGG + Intergenic
1185856707 X:3542826-3542848 ATGAGGGTCTTGGGGAGAGAGGG + Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187734701 X:22291960-22291982 TTGTGGGTTTTGAGCAGAGAAGG - Intergenic
1196193094 X:112814324-112814346 CTGGGGGCCTCAAGGAGACAGGG - Intronic
1199020084 X:142868740-142868762 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
1199243638 X:145576905-145576927 CTATGTGGCTAGAGGAGAGAAGG + Intergenic
1199610224 X:149606513-149606535 CTGTGGGAGTTGAGAAGAGAGGG - Intronic
1199666493 X:150100314-150100336 CTGAGAGTCTCCAGCAGAGATGG - Intergenic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic
1200807468 Y:7447296-7447318 ATGAGGGTCTTGGGGAGAGAGGG - Intergenic