ID: 1200115731

View in Genome Browser
Species Human (GRCh38)
Location X:153768953-153768975
Sequence TCTCCACGGCTCCCAGGGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 321}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200115725_1200115731 -8 Left 1200115725 X:153768938-153768960 CCCCACTCAGGTCTTTCTCCACG 0: 1
1: 0
2: 0
3: 8
4: 192
Right 1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG 0: 1
1: 0
2: 4
3: 32
4: 321
1200115728_1200115731 -10 Left 1200115728 X:153768940-153768962 CCACTCAGGTCTTTCTCCACGGC 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG 0: 1
1: 0
2: 4
3: 32
4: 321
1200115724_1200115731 -7 Left 1200115724 X:153768937-153768959 CCCCCACTCAGGTCTTTCTCCAC 0: 1
1: 0
2: 1
3: 21
4: 295
Right 1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG 0: 1
1: 0
2: 4
3: 32
4: 321
1200115720_1200115731 6 Left 1200115720 X:153768924-153768946 CCTCGTCCTTGTCCCCCCACTCA 0: 1
1: 0
2: 5
3: 11
4: 260
Right 1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG 0: 1
1: 0
2: 4
3: 32
4: 321
1200115723_1200115731 -6 Left 1200115723 X:153768936-153768958 CCCCCCACTCAGGTCTTTCTCCA 0: 1
1: 0
2: 6
3: 53
4: 326
Right 1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG 0: 1
1: 0
2: 4
3: 32
4: 321
1200115722_1200115731 0 Left 1200115722 X:153768930-153768952 CCTTGTCCCCCCACTCAGGTCTT 0: 1
1: 0
2: 0
3: 14
4: 285
Right 1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG 0: 1
1: 0
2: 4
3: 32
4: 321
1200115718_1200115731 11 Left 1200115718 X:153768919-153768941 CCCAGCCTCGTCCTTGTCCCCCC 0: 1
1: 0
2: 3
3: 18
4: 290
Right 1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG 0: 1
1: 0
2: 4
3: 32
4: 321
1200115726_1200115731 -9 Left 1200115726 X:153768939-153768961 CCCACTCAGGTCTTTCTCCACGG 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG 0: 1
1: 0
2: 4
3: 32
4: 321
1200115719_1200115731 10 Left 1200115719 X:153768920-153768942 CCAGCCTCGTCCTTGTCCCCCCA 0: 1
1: 0
2: 0
3: 36
4: 965
Right 1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG 0: 1
1: 0
2: 4
3: 32
4: 321
1200115716_1200115731 26 Left 1200115716 X:153768904-153768926 CCTTTGGCCATCTGGCCCAGCCT 0: 1
1: 0
2: 3
3: 36
4: 285
Right 1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG 0: 1
1: 0
2: 4
3: 32
4: 321
1200115717_1200115731 19 Left 1200115717 X:153768911-153768933 CCATCTGGCCCAGCCTCGTCCTT 0: 1
1: 0
2: 3
3: 37
4: 444
Right 1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG 0: 1
1: 0
2: 4
3: 32
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200115731 Original CRISPR TCTCCACGGCTCCCAGGGCC AGG Exonic
900154419 1:1198264-1198286 ACCCCACGGCCCCCATGGCCTGG + Intergenic
900159893 1:1218568-1218590 TCTCCACGGTGCCCACGGGCAGG + Exonic
900188740 1:1344568-1344590 TCCCCAGGCCACCCAGGGCCAGG + Intronic
900336138 1:2164779-2164801 CCTCCACGACACCCAAGGCCCGG - Intronic
900379174 1:2375375-2375397 TCTCCACGGATCCTGGGCCCTGG + Intronic
900472623 1:2862270-2862292 ACTCCTCGGGTCCCAGAGCCCGG + Intergenic
900527371 1:3135819-3135841 TCCCCGTGGCTCCCTGGGCCGGG + Intronic
900962564 1:5934605-5934627 TCCCCACTGCTCCCAGTCCCGGG + Intronic
901031887 1:6311889-6311911 TCACCCCGACTCCCAGGGTCTGG + Intronic
901241503 1:7696778-7696800 TCTCTACGGCTCCCTGTGCAGGG - Intronic
901325084 1:8360860-8360882 TCCCCAGGCCTCCCAAGGCCAGG - Exonic
901588313 1:10317008-10317030 GCTCCAGGGATCCCAGGGGCTGG + Intronic
901794674 1:11673439-11673461 TACCCACTCCTCCCAGGGCCAGG + Intronic
901953634 1:12768916-12768938 TCTTCACAGCTCCCAGAGCCTGG - Intergenic
902449319 1:16486544-16486566 TCTCCAGGGCTGCCTTGGCCCGG + Intergenic
902505429 1:16936733-16936755 TCTCCAGGGCTGCCTCGGCCCGG - Exonic
902628646 1:17691470-17691492 TCTCCAAGACCCCCAGGGCATGG - Intronic
902668153 1:17953632-17953654 TCTCCAGGGCTCCCTGACCCTGG - Intergenic
904534614 1:31190840-31190862 ACACCAAGGCTCCCAAGGCCAGG - Intronic
904899511 1:33845835-33845857 TCCACAAGGCTCCTAGGGCCAGG - Intronic
905059423 1:35126744-35126766 TGTCCACTGGTTCCAGGGCCTGG + Intergenic
905328989 1:37178958-37178980 TCTCCTGGGCTCCCACTGCCGGG - Intergenic
905669761 1:39784012-39784034 TCTCCACACAGCCCAGGGCCTGG - Intronic
906248560 1:44293983-44294005 TCTCCACAGCTCACAGGACATGG + Intronic
906480871 1:46198241-46198263 TCTCTCCTCCTCCCAGGGCCCGG + Intronic
906666904 1:47628322-47628344 CTTCCACTGCTCCCATGGCCTGG - Intergenic
907241583 1:53084108-53084130 CTTCCCCAGCTCCCAGGGCCCGG + Intronic
911070128 1:93825708-93825730 TCTCCTCTGCTCGCATGGCCTGG - Intronic
912490671 1:110060995-110061017 CCTCCAGGGCTCCCAGATCCTGG + Exonic
915145475 1:153793879-153793901 TGTCCCCTCCTCCCAGGGCCAGG - Intergenic
915565919 1:156712613-156712635 CCTCCCCAGCTCCCAGGGCAGGG + Intergenic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
919914674 1:202132214-202132236 TCTCCCGGGATCCCAGGCCCAGG + Exonic
920022223 1:202965144-202965166 TCTCCACAGCTGCCATGGCTAGG + Intronic
920173249 1:204084474-204084496 CCTCCAGGGCTGCCAGGACCAGG + Intronic
920951517 1:210575493-210575515 TCCCCAGGGCTCCCAGGCCCAGG - Intronic
921814627 1:219549620-219549642 TCACCACCACTCCCAGGGGCTGG + Intergenic
922178422 1:223215096-223215118 TCTTCAGTGCTTCCAGGGCCTGG - Intergenic
922222962 1:223622358-223622380 TCATCACTGCTGCCAGGGCCCGG + Intronic
922732089 1:227953991-227954013 GCTCCTCGGCTCACAAGGCCAGG + Intergenic
923033396 1:230267471-230267493 ATTCCCAGGCTCCCAGGGCCTGG + Intronic
924605525 1:245531458-245531480 TCTGCTGGCCTCCCAGGGCCAGG + Intronic
1065494361 10:26313669-26313691 TCTCCACGGCTGGCTGGGCCGGG + Intergenic
1066459170 10:35598049-35598071 AGTCCAGGGCTCGCAGGGCCAGG + Intergenic
1067222121 10:44351942-44351964 TCACCTGGGCTCTCAGGGCCTGG - Intergenic
1067829913 10:49605660-49605682 TCTCTACAGCTCCCAGGGACAGG - Intergenic
1070600683 10:77864331-77864353 TCTCCCGGGCAGCCAGGGCCTGG - Intronic
1071236750 10:83657861-83657883 TCTCCAGGGATCCCAGCTCCAGG - Intergenic
1071402238 10:85285157-85285179 TCCCCACTGCTCCCAGAGCGAGG - Intergenic
1071531345 10:86392249-86392271 ACTCCACGTCTCCCAGGCCTGGG + Intergenic
1071563866 10:86661746-86661768 TCAGCTCTGCTCCCAGGGCCTGG + Intronic
1073075565 10:100824079-100824101 TCTCCACACCTGCCAGGACCAGG + Intronic
1075825774 10:125356184-125356206 GCCCCTCGGCCCCCAGGGCCTGG + Intergenic
1075845846 10:125544545-125544567 TGTCTTCAGCTCCCAGGGCCTGG + Intergenic
1076029793 10:127147604-127147626 CCTCCCAGTCTCCCAGGGCCTGG + Intronic
1076035429 10:127195840-127195862 ACTCGGCGGCTCCCGGGGCCGGG - Intronic
1076494234 10:130886327-130886349 TGTCCACGGCCCACAGGCCCAGG - Intergenic
1076697574 10:132254497-132254519 TCTCCTGGGCTCCCAGGTCTGGG - Intronic
1076697599 10:132254602-132254624 TCTCCTGGGCTCCCAGGTCTGGG - Intronic
1076697624 10:132254707-132254729 TCTCCTGGGCTCCCAGGTCTGGG - Intronic
1076725387 10:132410635-132410657 CCCTCACGGCTCCCAGGACCAGG - Intronic
1076762956 10:132614738-132614760 TCTCATCGGCCCCCAGAGCCAGG - Intronic
1077037892 11:504105-504127 TCTCCGCAGCACCCAAGGCCTGG + Intronic
1077262306 11:1629337-1629359 TTTCCAAGGGTCCCAGGACCTGG - Intergenic
1077283639 11:1756512-1756534 TCTCCAGGGCTGACAGGGGCAGG - Intronic
1077362602 11:2147329-2147351 TCTCCACGGCACCGAGGTCCTGG - Intronic
1077391904 11:2304138-2304160 TCAGCACGGCTCCCAGAGTCAGG - Exonic
1077432298 11:2521926-2521948 GCTCCACGGCTCAGATGGCCTGG - Intronic
1077435071 11:2535027-2535049 TCTGCACAGCCCCCAGGGCACGG + Intronic
1077472757 11:2771961-2771983 TCTCCACTGCTCCCTGGCCCTGG + Intronic
1077472761 11:2771973-2771995 TCTGCAAGGCTCCCAGGGCCAGG - Intronic
1077535734 11:3123066-3123088 TGCCCACGGCTCCCAGGGGATGG - Intronic
1078453699 11:11458848-11458870 TTTCCACGGGTCTCAGTGCCTGG - Intronic
1078511817 11:11990163-11990185 TGTCCACTGCTCTCAGGACCTGG - Intronic
1078527984 11:12114990-12115012 TCTCCACCAAGCCCAGGGCCAGG - Intronic
1078606918 11:12785138-12785160 TCCCCACGGCTCCCAGGCACAGG - Intronic
1079021291 11:16911293-16911315 TCTCTAAGGCTGACAGGGCCAGG + Intronic
1079322780 11:19465297-19465319 TCTCCATGGCCACCATGGCCGGG - Intronic
1081669965 11:44937346-44937368 TTTCCACGCCTCCCAGGGTCTGG - Exonic
1081867300 11:46366845-46366867 GCTCTTCGGCCCCCAGGGCCAGG - Exonic
1083406152 11:62458709-62458731 CCTCCACTGCTCCCAAGGACAGG + Intronic
1085954828 11:81379071-81379093 TCTGGAAGGCTCCCAGGGCTGGG - Intergenic
1088317169 11:108519359-108519381 TCTCCATGGCTCCAATGGCTTGG + Intronic
1089364021 11:117910043-117910065 TCTGCTGTGCTCCCAGGGCCAGG + Intronic
1089628707 11:119770141-119770163 TATGCACAGTTCCCAGGGCCCGG - Intergenic
1089642469 11:119856827-119856849 TCTCCTCTGCCCCCAGGCCCTGG - Intergenic
1090085411 11:123645987-123646009 TCTCCACTGCTTCCAGGGGAAGG - Intronic
1090208349 11:124897956-124897978 TCTCCAAGGCACTGAGGGCCAGG - Exonic
1090601063 11:128371770-128371792 TTTGCACGGCTCCCAGAGGCAGG - Intergenic
1091638130 12:2213702-2213724 TCTGCAGGCCTCCCAGGCCCCGG + Intronic
1092160027 12:6310896-6310918 TCGCCCCGGCTTCCAGGCCCCGG - Intronic
1093126099 12:15330474-15330496 TCTCCACTGTGCCCAGTGCCAGG + Intronic
1093153149 12:15647892-15647914 TTTCCATGGACCCCAGGGCCGGG + Intronic
1095098296 12:38159418-38159440 ACTCCAAGACCCCCAGGGCCAGG - Intergenic
1095960136 12:47829104-47829126 ACTCCACCTCTCCCAGGTCCTGG - Intronic
1101436714 12:104670328-104670350 TCTGCACGGCACCCAGGGCAGGG + Intronic
1102101520 12:110281774-110281796 TCTCCATGGCTTCGGGGGCCCGG - Exonic
1103342507 12:120228604-120228626 TCCCCACTGCGCCCATGGCCAGG - Intronic
1103910516 12:124349633-124349655 TCTCGTCTGCTCCCTGGGCCAGG - Intronic
1104450819 12:128866996-128867018 TCTCCCCGTCTCCCTGGGGCTGG + Intronic
1105642841 13:22284220-22284242 TCCCCACCGCTCCCCGGCCCTGG + Intergenic
1106048649 13:26169236-26169258 TCTCCACGGCTCCCTGAGCCTGG - Intronic
1106218131 13:27721193-27721215 TCTCCTCTGCTCCCAGCCCCTGG - Intergenic
1106772431 13:32974800-32974822 TATCCTCTGCTCCCAGGCCCTGG + Intergenic
1107859972 13:44651338-44651360 TCTCCACTCCTTCCAGAGCCTGG + Intergenic
1108185505 13:47884727-47884749 TCTCCAAGGCTGTCAGGGCTGGG + Intergenic
1108400382 13:50035743-50035765 TCTCCACTGGTCCCACCGCCAGG - Intergenic
1108585681 13:51867748-51867770 TCTCCATGGGTCCCAGGGCAAGG + Intergenic
1112685247 13:101817157-101817179 TCTCCCAGGATCACAGGGCCTGG + Intronic
1117920723 14:60723456-60723478 TGTCTACGGCTCCCAGCGGCCGG + Exonic
1117954349 14:61111192-61111214 ACTCCACGGCTACCAGGCACAGG - Intergenic
1120502815 14:85318058-85318080 TCTTCTGGGCTCCCAAGGCCTGG - Intergenic
1121017779 14:90558843-90558865 TCCCCAGGGCCCCCAGGGCTTGG + Intronic
1121539104 14:94711726-94711748 TCTCCAAGGCTGCCTGGGACAGG + Intergenic
1122110621 14:99498409-99498431 TCTTCACTGCTCCCAGCTCCAGG - Intronic
1122244742 14:100394544-100394566 TCCCCTCTGATCCCAGGGCCTGG - Intronic
1122274824 14:100586166-100586188 CCCCCACTACTCCCAGGGCCAGG - Intronic
1122366452 14:101197582-101197604 TCTCCAGGGCCCACAGAGCCTGG + Intergenic
1122706740 14:103626610-103626632 TCAACAAGGCCCCCAGGGCCTGG - Intronic
1124339502 15:28880913-28880935 TCTACGTGGCTCCCAAGGCCAGG + Intergenic
1124558048 15:30746024-30746046 TCTGCAGGGCTGCCAGGCCCTGG - Intronic
1124673196 15:31659625-31659647 TCTGCAGGGCTGCCAGGCCCTGG + Intronic
1125731974 15:41897601-41897623 TCTCCCCAGCTCCCAGGGAGGGG - Exonic
1126846730 15:52766977-52766999 TGTCCACCCCTCCCAGGCCCAGG - Intronic
1127812908 15:62580051-62580073 TCTACACCTCTCCCAGGCCCTGG + Intronic
1128091482 15:64922046-64922068 TCCCCTCGGCTCCCCTGGCCTGG + Intronic
1128455732 15:67830324-67830346 TCTCCACCGCACCCAGGAGCTGG + Intronic
1128807232 15:70540094-70540116 TCTCCACAGACTCCAGGGCCTGG - Intergenic
1129016535 15:72474184-72474206 TCCCCTCGGGTCCCAGGCCCAGG + Intergenic
1129153522 15:73703648-73703670 CCTCCACGGCTCCTGGGGGCGGG - Exonic
1130518681 15:84645683-84645705 TCTCCACCAGACCCAGGGCCAGG + Exonic
1130995534 15:88901769-88901791 GATCCACAGCTCCCAGGGGCAGG + Intronic
1132178330 15:99733093-99733115 GCTCCACGGCTCCACGGGCGGGG + Intronic
1132641943 16:982027-982049 TCCCGCCGGCTCCGAGGGCCTGG + Exonic
1132661267 16:1062530-1062552 TCCCCTCGGCTCCCACGGCCGGG - Intergenic
1133177083 16:4023597-4023619 TCTTAATGGCTCCCAGGGCCTGG - Intronic
1133784602 16:8964126-8964148 CCGCCTCGGCCCCCAGGGCCCGG - Intronic
1136406577 16:30051589-30051611 TCACCAAGGCTCCCAGGGCTAGG + Intronic
1136507101 16:30711621-30711643 TCTTCACTGCTCCCAGAGCCTGG - Exonic
1137272080 16:46908419-46908441 TGCACACGCCTCCCAGGGCCTGG + Intronic
1137787598 16:51151362-51151384 CCTCCCCGGCTCCCCGGCCCCGG + Intronic
1139572939 16:67824665-67824687 TCTCCTCAGCTCTCATGGCCAGG - Exonic
1140456031 16:75106096-75106118 TCTCCAAGACTCCCAAGGGCAGG - Intronic
1140986766 16:80165472-80165494 CCGTCAGGGCTCCCAGGGCCAGG - Intergenic
1141456337 16:84144949-84144971 TCACCACGCCCCCCAGGCCCCGG - Intronic
1141464081 16:84195399-84195421 GCTCCACGACTGCCATGGCCTGG + Exonic
1141523446 16:84596625-84596647 TTCCCACGGCACCCAGGGCATGG + Intronic
1141700879 16:85641493-85641515 CCTACAAGGCTCCCAGGGCAGGG - Intronic
1141799097 16:86295176-86295198 TCTGCACCCCTCCCAAGGCCTGG + Intergenic
1142567505 17:850242-850264 TCCCCACGAGCCCCAGGGCCTGG + Intronic
1142602208 17:1059179-1059201 GCCCCACGTCACCCAGGGCCAGG + Intronic
1143608405 17:8003649-8003671 TGTCCACGGCACTCAGGGCCCGG + Exonic
1144807948 17:17979892-17979914 TCTCCTGGGTTCCCAGGGCTGGG - Intronic
1144807985 17:17980022-17980044 TCTCCTGGGTTCCCAGGGCTGGG - Intronic
1145267185 17:21385540-21385562 TCTTCAAGGCTCCCAGGGCCTGG - Intronic
1145883053 17:28365526-28365548 TCTCCAGTGCTCCCAGGCACTGG + Intronic
1146484350 17:33231271-33231293 TCTCCATGCCTCCCAGGCCTAGG + Intronic
1147967159 17:44199607-44199629 TCTCCCCGGGGCCCAGGGCCCGG + Intronic
1149597218 17:57871406-57871428 GCTCCTGGGCTCCCAGGGGCAGG + Intronic
1151314007 17:73311107-73311129 TCTCCCCGGCTCCAAGGGGGCGG + Intronic
1151812691 17:76453538-76453560 TCTGCAATGCTCCCAGTGCCTGG - Exonic
1152925648 17:83086514-83086536 TCTCCAGGGCCCCCAGAGCAAGG - Intronic
1152934663 17:83129017-83129039 TCTCCACCACGCCCGGGGCCGGG + Intergenic
1153851899 18:9102751-9102773 TCTCCGCGGCGCTCCGGGCCCGG + Exonic
1157223325 18:45842097-45842119 TGTCCACAGGTCCCAGGCCCAGG + Exonic
1159445279 18:68534999-68535021 GCTCCACGGGTGCCTGGGCCGGG + Intergenic
1159908336 18:74119044-74119066 TCATCCCGCCTCCCAGGGCCTGG - Intronic
1160515718 18:79478301-79478323 TCTTCACGGCTCCCAGATCAGGG - Intronic
1160687055 19:441969-441991 TCTCCACGGCTCCATGTACCTGG + Intronic
1160773921 19:846215-846237 GCCCCACGGCACCCAGTGCCTGG + Exonic
1160829816 19:1098517-1098539 TCTGCTCTGCTCCCAGGACCTGG - Intergenic
1160915885 19:1496301-1496323 TCTGCATGGCTCCCAGGCCCTGG + Exonic
1160951099 19:1667771-1667793 ACCCCACGGCGCCCTGGGCCAGG - Intergenic
1161756983 19:6141369-6141391 TCTCCTCTCCTCCCAGGCCCAGG + Intronic
1161777298 19:6270511-6270533 TCTTCACTCCTCCCAAGGCCAGG - Intronic
1162042474 19:7979115-7979137 TCCCCGAGGCTCCCTGGGCCTGG - Intronic
1162233558 19:9286635-9286657 TCTCCTCTGCTTCCAGGCCCTGG + Intergenic
1162463370 19:10826436-10826458 TCTCCAGGGAACCCGGGGCCAGG - Intronic
1162568512 19:11457416-11457438 TCCCCAGGGATCCCAGCGCCTGG - Intronic
1162793314 19:13074058-13074080 TCTCCACTCCCCCCAGGGCCAGG + Intronic
1162805046 19:13133430-13133452 TCTCCCCGCCTCCCAGCCCCTGG + Intronic
1162819159 19:13212342-13212364 CCCCAATGGCTCCCAGGGCCCGG - Intronic
1162917366 19:13881611-13881633 TCCCAGCGGCTCCCAGGGTCTGG + Intergenic
1163322828 19:16584569-16584591 TCCCCACTGCTCCCAGGGTGTGG - Intronic
1163727651 19:18931921-18931943 TCTCCACAGTTGCCCGGGCCAGG + Intronic
1165022286 19:32934780-32934802 TCTCCACTCCTACCAGGGCAAGG - Intronic
1165064949 19:33223641-33223663 CCTCAAAGGCTCCCCGGGCCAGG + Intronic
1165087284 19:33359612-33359634 TCTCTCCTGCTCCCAGGCCCTGG + Intergenic
1165480230 19:36058993-36059015 TCTCCACAGCTCTCAGAGGCAGG - Intronic
1166420109 19:42630149-42630171 TTTCCAGGGCTCCCTGGTCCTGG - Intronic
1167975778 19:53224855-53224877 TCTCCGCGGCGCTCCGGGCCCGG - Intergenic
1168107629 19:54174136-54174158 GCCCCAGGGCTGCCAGGGCCAGG + Exonic
1168269430 19:55241560-55241582 TTTCCAGGGCCCCCTGGGCCAGG + Exonic
1168650393 19:58088709-58088731 TCTCCCCAGCTCCAAGGGCCTGG + Exonic
925317842 2:2939049-2939071 CCTCCACAGCTCCCAGGGGTGGG - Intergenic
925905091 2:8535418-8535440 TCTCCTCCGCTCCCAGGCCTGGG + Intergenic
925971684 2:9110725-9110747 TTTCCAGGCCTCCCAGAGCCAGG + Intergenic
926116712 2:10218079-10218101 TCCCCACTGCTGCCAGTGCCCGG + Intergenic
926724194 2:15984623-15984645 TCCACACGGCTCCCTGGGCATGG + Intergenic
927694556 2:25231114-25231136 TCTTCCCGGCTCCCAGGGTCAGG - Exonic
928172070 2:29010398-29010420 TCGCCATTGCTCCCAGGGCCAGG - Intronic
930618752 2:53622840-53622862 TGTCCAGGGCTGCCAGTGCCTGG - Intronic
932373491 2:71213044-71213066 TCCCCACTGCTCCCCAGGCCAGG - Intronic
932421592 2:71604498-71604520 TCTCATGGGCTCCCATGGCCAGG - Intronic
934882401 2:97995591-97995613 TCTCCACGTCCGCCGGGGCCGGG - Exonic
935259431 2:101342182-101342204 GCTCCTGGGCTTCCAGGGCCAGG - Intergenic
938727993 2:134123558-134123580 CCTCCATGCCTCCTAGGGCCAGG - Intronic
940625946 2:156175454-156175476 TCTCCTCTGCTCCCAGGGCTTGG - Intergenic
944676014 2:202034505-202034527 GCTCCACGCCGCCCACGGCCCGG + Intergenic
945066257 2:205949858-205949880 TCACGACTGCTCCCTGGGCCAGG - Intergenic
945450138 2:209984868-209984890 CCTCGATGACTCCCAGGGCCTGG + Exonic
946327617 2:218992916-218992938 TCTCCAGGGCTCACAGGACAGGG + Intronic
946402435 2:219475691-219475713 GCTGCAGGGCTCTCAGGGCCAGG - Intronic
947528594 2:230894400-230894422 TCTTCACGGCTCCCAGCCTCGGG - Intergenic
948542178 2:238698928-238698950 TGTCAAAGGCACCCAGGGCCTGG + Intergenic
948687322 2:239677430-239677452 TCTCCTCAGTTCCCAGGGCTGGG + Intergenic
948708904 2:239813257-239813279 TCTCCAGGCCGTCCAGGGCCCGG + Intergenic
1168890654 20:1293715-1293737 TCTCCTGGGCACCCAGAGCCAGG - Intronic
1168927597 20:1595582-1595604 TGTCCAAGGCTCCCAGGTCTGGG - Intronic
1168961079 20:1870463-1870485 TCTCCACTGCCACCAGAGCCTGG + Intergenic
1172952209 20:38729419-38729441 TTCCCACGCCTCCCAGCGCCAGG - Intergenic
1173556616 20:43970753-43970775 TCTCCAAATCTCCCAGAGCCTGG - Intronic
1173572310 20:44085358-44085380 TCAGCACAGCTCCCAGGGCAGGG + Intergenic
1174044088 20:47721039-47721061 GCTCCACAGCTCTCAGGGCTGGG + Intronic
1175264281 20:57693146-57693168 ACCCCACGCCTCCCAGGGCCAGG + Intronic
1175733544 20:61370326-61370348 TCTGCATGGATCCCAGAGCCGGG - Intronic
1175810085 20:61853150-61853172 TCCCCAGGACTCCCAGTGCCCGG - Intronic
1176197497 20:63844225-63844247 TCTGCCCAGCTCCCAGGACCAGG - Intergenic
1176203227 20:63873694-63873716 TCTCCTTGGCTGCCAGGACCTGG - Exonic
1176211996 20:63929155-63929177 TCTCCAGGGCTGCAGGGGCCAGG - Intronic
1176265110 20:64205185-64205207 TTTCCATGGCTCCCAAGGCCAGG + Intronic
1176421544 21:6520135-6520157 CCTCCATGGCTCCCAGTCCCTGG + Intergenic
1176997394 21:15571387-15571409 TCTCCCCATCTCCCAGGTCCTGG - Intergenic
1179641808 21:42752635-42752657 GCTTCACGGCTCCCTGGGACAGG - Intronic
1179697034 21:43128451-43128473 CCTCCATGGCTCCCAGTCCCTGG + Intergenic
1179767627 21:43584861-43584883 TTTCCATGGCTCCCAGGGTGTGG - Intronic
1179868462 21:44230197-44230219 TCCCCAAGGCTCCCAGCTCCAGG + Intronic
1179879114 21:44286168-44286190 TATCCCTGGCTCACAGGGCCTGG - Intronic
1179954026 21:44727915-44727937 ACCCCTGGGCTCCCAGGGCCTGG + Intergenic
1180049446 21:45324647-45324669 TGTCCAAGGCCCCCAGGGGCTGG + Intergenic
1180054024 21:45347906-45347928 CCTCCAGGGATCCCAGGACCAGG + Intergenic
1180198731 21:46212466-46212488 TCTACAGGGCCCCCAGAGCCAGG + Intronic
1180824702 22:18854516-18854538 TCACCCTGTCTCCCAGGGCCAGG + Intronic
1180840675 22:18957555-18957577 TCTGCACTGCCCCCAGGGTCTGG + Intergenic
1181188028 22:21120031-21120053 TCACCCTGTCTCCCAGGGCCAGG - Intergenic
1181211170 22:21290462-21290484 TCACCCTGTCTCCCAGGGCCAGG + Intergenic
1181398334 22:22636426-22636448 TCACCCTGTCTCCCAGGGCCAGG - Intergenic
1181437460 22:22918989-22919011 TCTCCTGGACTCCCAGGACCCGG + Intergenic
1181501072 22:23315789-23315811 TCACCCTGTCTCCCAGGGCCAGG - Exonic
1181532016 22:23522214-23522236 CCTCCCCGGTGCCCAGGGCCCGG + Intergenic
1181706300 22:24651105-24651127 TCACCCTGTCTCCCAGGGCCAGG - Intergenic
1182128369 22:27832914-27832936 TCTCCACAGACCCCAGAGCCTGG - Intergenic
1183103371 22:35597836-35597858 TCCCAATGGCTACCAGGGCCTGG - Intergenic
1183420555 22:37709281-37709303 TCCCCAGGGATCCCAGGCCCAGG + Intronic
1183543670 22:38444210-38444232 TCACCCCGACTCCCAGAGCCTGG + Intronic
1184003678 22:41693637-41693659 TCTCCACAGCACCCATGTCCAGG + Exonic
1184116558 22:42426040-42426062 TCTACACTGCTCCCTGGGTCTGG - Intronic
1184424011 22:44398508-44398530 TCTCAACAGTCCCCAGGGCCGGG + Intergenic
1184837516 22:47032653-47032675 TCTCCAATGCTGCCAGGGCAGGG - Intronic
1185043420 22:48517321-48517343 TCTCCCCAGGTCCCAGGTCCTGG + Intronic
1185171506 22:49297257-49297279 TCCCCACCGATGCCAGGGCCAGG - Intergenic
1203215778 22_KI270731v1_random:4969-4991 TCACCCTGTCTCCCAGGGCCAGG - Intergenic
1203274848 22_KI270734v1_random:80422-80444 TCACCCTGTCTCCCAGGGCCAGG + Intergenic
950034714 3:9877144-9877166 GCCCCAAGGCCCCCAGGGCCCGG - Exonic
961001644 3:123378212-123378234 TATCCACCCCTCCCAGGGACTGG - Intronic
961448854 3:126993391-126993413 TGTCCTCTGCTCCCTGGGCCAGG + Intronic
961692630 3:128681012-128681034 TCACCGCGTCTCCCAGGGACAGG - Intronic
963080010 3:141382759-141382781 TTCCCACAGTTCCCAGGGCCTGG + Intronic
966930679 3:184673558-184673580 TCTCCAGGGCCAGCAGGGCCTGG + Intronic
969454983 4:7295511-7295533 TCTCGGCTGCTCCCAGGGCTGGG - Intronic
969583832 4:8080746-8080768 TGTCCAAGGCTACCAGGGCCTGG + Exonic
969720619 4:8891478-8891500 TCTCCACTGTTCCCAGCACCGGG + Intergenic
972730302 4:41788229-41788251 TCTCCCCCACTCCCAGGGCTGGG - Intergenic
980811425 4:137886409-137886431 TTTCCACTTCTCCCAGGCCCTGG + Intergenic
982169010 4:152643472-152643494 TCTGCAAGGCTCCCAGGGTGAGG + Intronic
982202726 4:152975340-152975362 CCTCCAGGGTTCCCAGGGCATGG + Exonic
984838266 4:184042412-184042434 TCTCCACTCCTCCCAGCTCCTGG + Intergenic
985778307 5:1856896-1856918 ACGCCCCCGCTCCCAGGGCCGGG + Intergenic
985924387 5:3004567-3004589 TGTCTACGGCACCCTGGGCCTGG + Intergenic
985933918 5:3080146-3080168 TCTCCAGGGCTCCACGGACCTGG - Intergenic
987083374 5:14446271-14446293 TCTCCAGTGCTGCCAGTGCCTGG - Intronic
994094760 5:95838903-95838925 TCTCCTCAGCTGGCAGGGCCTGG - Intergenic
997869930 5:137498334-137498356 GCTCCGCGCCCCCCAGGGCCGGG + Intronic
1001381252 5:171308194-171308216 TGTCCACGGTGCCCTGGGCCGGG + Exonic
1002195017 5:177496884-177496906 TCTCCCCCGCCCCCAGGTCCCGG + Intronic
1002632401 5:180590617-180590639 CCTTCACGGCCCCCACGGCCTGG + Exonic
1002851813 6:1003458-1003480 TGTGCAGGGGTCCCAGGGCCCGG - Intergenic
1003049476 6:2766252-2766274 TCTCCTCGGCAGCCAGCGCCCGG - Exonic
1003635610 6:7828936-7828958 TCTCCCCGTGTCCCAGGGCTTGG + Intronic
1005655964 6:27937776-27937798 ACTCCACCCCTCCCAGGGCCAGG - Intergenic
1006083533 6:31581011-31581033 TCTCGTCGGCTACCGGGGCCGGG - Exonic
1006435053 6:34021725-34021747 TCTCCACAGCCCCCAAGCCCTGG + Intronic
1008960210 6:57258822-57258844 TCTCCTCCGCTCCCAGAACCTGG + Intergenic
1010116403 6:72316947-72316969 TCTCCACAGAGCCTAGGGCCTGG - Intronic
1010129731 6:72476905-72476927 TCACTTCGGCTCCCAGAGCCCGG + Intergenic
1010787758 6:80024584-80024606 TCCCCACTGCTCCCAGCCCCTGG - Intronic
1013158872 6:107522212-107522234 TCTCCATGGCTCCTAAGACCAGG - Intronic
1014137787 6:117908078-117908100 ACTCCAGGGCTCCCTGCGCCGGG - Intronic
1015941029 6:138452133-138452155 TCTCCATTCCTCCCAGGACCAGG - Intronic
1016462816 6:144296129-144296151 GCTCCCCAACTCCCAGGGCCTGG + Intronic
1016824982 6:148379903-148379925 TCACCACCCCTCCCAGGCCCAGG + Intronic
1018074894 6:160203239-160203261 TCTCCCTAGGTCCCAGGGCCTGG - Intronic
1019161934 6:170074722-170074744 TCCACCCGGCTCCCAGGCCCAGG - Intergenic
1019294608 7:267122-267144 TCTCCGTGGGTCCCAGGGCTCGG + Intergenic
1019644208 7:2120466-2120488 TCTGCACGGCTTCCAGAGCCTGG + Intronic
1019734489 7:2644096-2644118 TCCCCTGGGCTCCCATGGCCTGG - Intronic
1020093548 7:5355035-5355057 TCTCCACCCGCCCCAGGGCCTGG + Intronic
1020254433 7:6494812-6494834 TCTCCCCTACTCCCAGGGCCTGG - Intergenic
1020280681 7:6648487-6648509 CCTCCACTGCTCCCCGGGTCAGG - Intronic
1021030279 7:15724333-15724355 TGTCCACAGCTTCCAGGGCAGGG + Intergenic
1024039545 7:45541295-45541317 TCTCCCCAGCCCCCAGGTCCTGG - Intergenic
1025673757 7:63629230-63629252 TCTCAACGGCCCCCTGGGGCGGG + Intergenic
1029420479 7:100469437-100469459 GCTCAACAGCCCCCAGGGCCGGG + Intronic
1029590653 7:101504646-101504668 TCTCCAGGGCACCCAGAGGCTGG + Intronic
1029750397 7:102539688-102539710 TGTCCCCGGCCCCCAGAGCCCGG - Intronic
1029768349 7:102638796-102638818 TGTCCCCGGCCCCCAGAGCCCGG - Exonic
1031375320 7:121017543-121017565 TCTGCACGGCTCCAAGAGCATGG - Intronic
1032265621 7:130368149-130368171 TGTGCACAGCTCCCAGTGCCTGG + Intronic
1033671102 7:143494018-143494040 TCTCAATGGCTCCCAGGCCATGG - Intergenic
1034946650 7:155266753-155266775 CCTCCACGGCTGCCTCGGCCAGG - Intergenic
1035294793 7:157861004-157861026 TCTCCACAGCTCCCTGGACTGGG - Intronic
1035308807 7:157952166-157952188 TCTGGGGGGCTCCCAGGGCCTGG - Intronic
1035926793 8:3736573-3736595 TCACCATGGCTCCCAGGCCCTGG + Intronic
1036785497 8:11683258-11683280 GCTCTGCGCCTCCCAGGGCCAGG - Intronic
1038577554 8:28717775-28717797 TCTCCACTGGCCCCAGGTCCAGG - Exonic
1038870691 8:31489968-31489990 TCCCCAGGGCTGGCAGGGCCAGG - Intergenic
1043394905 8:79826800-79826822 TCTCCAGGGCAGCCAGGGCCTGG - Intergenic
1044769726 8:95618467-95618489 TCTCCATGGCTCCCAGGGGTTGG + Intergenic
1045505970 8:102779010-102779032 TCCCCTCTCCTCCCAGGGCCTGG - Intergenic
1048469583 8:134695349-134695371 ACTCCCCGGCTGCCAGGCCCAGG + Intronic
1049223176 8:141437043-141437065 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223206 8:141437117-141437139 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223221 8:141437154-141437176 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223236 8:141437191-141437213 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223251 8:141437228-141437250 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223266 8:141437265-141437287 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223280 8:141437302-141437324 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049329006 8:142039733-142039755 TCTTCTCAGCTCCCAAGGCCAGG + Intergenic
1049480041 8:142818279-142818301 GCTCCGCGGCTCCCTGGGCCCGG - Intergenic
1049498109 8:142946189-142946211 GCTCCCCGGCTGCCTGGGCCTGG + Intergenic
1055432475 9:76258041-76258063 TTTCCACAGCTCCCAGGTACAGG + Intronic
1056251562 9:84753626-84753648 TCTCAACTGCACCCAGGCCCAGG + Intronic
1057216389 9:93231128-93231150 TCTCATGGGCTCCAAGGGCCTGG - Intronic
1057719554 9:97520920-97520942 TCTCCCCTGCTCCCTCGGCCTGG + Intronic
1059659587 9:116387996-116388018 TCTTCCCGGTTCCCAGGGCTAGG + Intronic
1060397265 9:123325014-123325036 CCCCCAGGCCTCCCAGGGCCAGG - Intergenic
1060740608 9:126095491-126095513 CCACCACGGCTCCCATGACCAGG - Intergenic
1062077406 9:134598419-134598441 TGTGCACGGGTCCCAGGGGCGGG - Intergenic
1062178145 9:135175772-135175794 TCCCCACAGCCCCCAGAGCCAGG + Intergenic
1062334314 9:136058327-136058349 TCCCCACGGCTCCCAGTGCCTGG + Intronic
1062430016 9:136522794-136522816 CCTCCCCGGCTGCCAGGCCCAGG - Intronic
1062449691 9:136610285-136610307 CCTCTGGGGCTCCCAGGGCCAGG + Intergenic
1185478826 X:431044-431066 GGTCCAGGGTTCCCAGGGCCAGG - Intergenic
1188078526 X:25807850-25807872 TCCCCATGGCCACCAGGGCCGGG + Intergenic
1192261064 X:69505992-69506014 GCTACACGCCTCCCAGGCCCCGG - Exonic
1195154955 X:102113626-102113648 CCACAACAGCTCCCAGGGCCAGG - Intergenic
1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG + Exonic
1200215828 X:154367857-154367879 CCACCAGGGCGCCCAGGGCCCGG + Exonic