ID: 1200116318

View in Genome Browser
Species Human (GRCh38)
Location X:153771214-153771236
Sequence GAACAATCACATTCATTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 238}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200116312_1200116318 0 Left 1200116312 X:153771191-153771213 CCCAGTCTTGGGGGAGAGGCAGG 0: 1
1: 0
2: 6
3: 45
4: 459
Right 1200116318 X:153771214-153771236 GAACAATCACATTCATTCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 238
1200116304_1200116318 21 Left 1200116304 X:153771170-153771192 CCATAACCTCTGTCTGTGGGCCC 0: 1
1: 0
2: 2
3: 22
4: 161
Right 1200116318 X:153771214-153771236 GAACAATCACATTCATTCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 238
1200116311_1200116318 1 Left 1200116311 X:153771190-153771212 CCCCAGTCTTGGGGGAGAGGCAG 0: 1
1: 0
2: 6
3: 69
4: 461
Right 1200116318 X:153771214-153771236 GAACAATCACATTCATTCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 238
1200116303_1200116318 22 Left 1200116303 X:153771169-153771191 CCCATAACCTCTGTCTGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1200116318 X:153771214-153771236 GAACAATCACATTCATTCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 238
1200116305_1200116318 15 Left 1200116305 X:153771176-153771198 CCTCTGTCTGTGGGCCCCAGTCT 0: 1
1: 0
2: 6
3: 47
4: 348
Right 1200116318 X:153771214-153771236 GAACAATCACATTCATTCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 238
1200116314_1200116318 -1 Left 1200116314 X:153771192-153771214 CCAGTCTTGGGGGAGAGGCAGGG 0: 1
1: 0
2: 5
3: 74
4: 647
Right 1200116318 X:153771214-153771236 GAACAATCACATTCATTCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200116318 Original CRISPR GAACAATCACATTCATTCTG GGG Intronic