ID: 1200118686

View in Genome Browser
Species Human (GRCh38)
Location X:153780566-153780588
Sequence TAGAAGAAGCAGGAAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 563}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200118681_1200118686 5 Left 1200118681 X:153780538-153780560 CCCAGTTGTCCTAGGGGCTGATG 0: 1
1: 0
2: 1
3: 4
4: 118
Right 1200118686 X:153780566-153780588 TAGAAGAAGCAGGAAGTGGCTGG 0: 1
1: 0
2: 2
3: 44
4: 563
1200118682_1200118686 4 Left 1200118682 X:153780539-153780561 CCAGTTGTCCTAGGGGCTGATGA 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1200118686 X:153780566-153780588 TAGAAGAAGCAGGAAGTGGCTGG 0: 1
1: 0
2: 2
3: 44
4: 563
1200118683_1200118686 -4 Left 1200118683 X:153780547-153780569 CCTAGGGGCTGATGAAACATAGA 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1200118686 X:153780566-153780588 TAGAAGAAGCAGGAAGTGGCTGG 0: 1
1: 0
2: 2
3: 44
4: 563
1200118677_1200118686 28 Left 1200118677 X:153780515-153780537 CCACATTCAGAGGGCACTGGACT 0: 1
1: 0
2: 1
3: 15
4: 152
Right 1200118686 X:153780566-153780588 TAGAAGAAGCAGGAAGTGGCTGG 0: 1
1: 0
2: 2
3: 44
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200118686 Original CRISPR TAGAAGAAGCAGGAAGTGGC TGG Intronic
900177708 1:1298165-1298187 AAGGTGAAGCAGGAAGTGGGTGG - Intronic
900385220 1:2407504-2407526 TAGGACAGCCAGGAAGTGGCTGG - Intronic
900752969 1:4410894-4410916 AAGAAGAACCAGGAAGATGCGGG - Intergenic
901164318 1:7206929-7206951 TAGAAGAAGCAGGCCGGGGGTGG - Intronic
901319284 1:8329919-8329941 TGGAACAGGCAGGAAGTGGAAGG + Intronic
901804525 1:11729721-11729743 GAGAAGAACGAGGAAGTGGGTGG - Intergenic
902255238 1:15184645-15184667 TGGCAGAAGCAGGAAGTAGGTGG + Intronic
902542932 1:17167164-17167186 CAGAAGCAGCAGGCAGGGGCTGG - Intergenic
902558955 1:17265057-17265079 AAGAAGAAGCAGTGAGGGGCAGG - Intronic
902599912 1:17533945-17533967 AAGAAGAAGAAGAAAGTGGGTGG - Intergenic
903157680 1:21459263-21459285 TTGAAGAAGCAGTAAGTTGGAGG + Intronic
903311566 1:22461999-22462021 TTGAACAAGTAGGAAGTGGCAGG + Intronic
903516482 1:23914389-23914411 TAAAATAAACAGGAAGTGGCTGG - Intergenic
904089603 1:27935498-27935520 TAGTAGAGGTAGGAGGTGGCAGG + Intronic
904350048 1:29899177-29899199 TAGAGGAAGGAAGAAGTGGGGGG + Intergenic
904600206 1:31668777-31668799 AAGAAGAAGCTGGCAGGGGCTGG - Intronic
905467290 1:38164853-38164875 GGGAATAAGCAGTAAGTGGCTGG - Intergenic
905612726 1:39368796-39368818 TAGAAAAACCACTAAGTGGCTGG - Intronic
905838495 1:41152006-41152028 TAGAAGAGGCAGAAAGTGGGTGG + Intronic
905979094 1:42207122-42207144 TAGAAGAAATAAGAACTGGCTGG - Intronic
906208235 1:43998176-43998198 TGGAAGAAGCAGGCAGGGCCGGG + Intronic
907629619 1:56067158-56067180 GCTAAGAAGCAGGAAGGGGCAGG - Intergenic
907632385 1:56095670-56095692 GAAAAGAAGCAGGATGGGGCAGG - Intergenic
907683166 1:56583332-56583354 GAGAAAAGGCAGGAAGGGGCAGG + Intronic
907871040 1:58443115-58443137 AAGGAGGAACAGGAAGTGGCAGG - Intronic
908286283 1:62607221-62607243 TAGCAGTAGCAGTAAGGGGCTGG - Intronic
909949661 1:81704562-81704584 TGGAAGCAGCAGCAAATGGCAGG - Intronic
910157461 1:84235016-84235038 TAGAAGAAGCAGCAAGCAGTAGG - Intronic
910217243 1:84854853-84854875 TAGAAGAAGCAGGAACTAGAAGG + Intronic
910698273 1:90045236-90045258 TAGAAGAATCAGTGGGTGGCAGG + Intergenic
910929452 1:92428549-92428571 TAGAATAAGCAAGACATGGCCGG + Intergenic
910961791 1:92771150-92771172 TTGAAGAGGGAGGAAGCGGCTGG - Intronic
911701054 1:100952024-100952046 TTGAAGATGGAGGAAGAGGCCGG + Intronic
912194023 1:107376979-107377001 TAGGAAAAGCAGGGAGTTGCAGG + Intronic
912275109 1:108248263-108248285 TTGAAGAAGCAGTAAGTTGTAGG - Intergenic
912293113 1:108446086-108446108 TTGAAGAAGCAGTAAGTTGTAGG + Intronic
912702310 1:111887562-111887584 TAGAGGAACCAGGCAGTGACCGG - Intronic
912702433 1:111888225-111888247 GAGAAGAAGCTGGAGGTGGTGGG + Intronic
912769272 1:112448053-112448075 TATAAGGATCAGGAAGTGGGTGG - Intronic
913326046 1:117629833-117629855 TAGAAAAAGCAGGAAGGGGGAGG - Intergenic
914430472 1:147616469-147616491 TAGAAAAAGCATACAGTGGCCGG + Intronic
914808313 1:151007974-151007996 GAGAAGCAGCAGGAGTTGGCAGG + Intronic
915119494 1:153619994-153620016 AAGAAGAAGCAGGAAGGGTGCGG + Intronic
915479186 1:156173519-156173541 TAGAAGAAGGGATAAGTGGCAGG + Intronic
916025447 1:160829740-160829762 TAGAGGCAGCAGGAAATGACGGG - Intergenic
916045549 1:160997549-160997571 GATAAGAACCAGGAAGGGGCAGG + Exonic
916271476 1:162947390-162947412 GAGAGGAAGAATGAAGTGGCAGG - Intergenic
916931109 1:169578866-169578888 TAGAAGAAGCAGGAAGCATTGGG - Intronic
917775678 1:178331881-178331903 TAAATGATGCATGAAGTGGCTGG - Intronic
918381846 1:183963822-183963844 TGGAAGAGGAGGGAAGTGGCTGG + Intronic
919681928 1:200444113-200444135 GAGAAAAAGTAGGAAGGGGCAGG - Intergenic
920239118 1:204531098-204531120 TACATGAAGCAGGGAGTGGGTGG + Intronic
920517533 1:206597372-206597394 TAGGAAAAGCAGGAGGTGGAAGG + Intronic
921150898 1:212401969-212401991 TAAAAGAATGAGGAACTGGCTGG - Intronic
921233794 1:213102402-213102424 AAGAAGAACCAAGAAGTGGAAGG - Intronic
921768449 1:219003102-219003124 TAGAAGAAGAAAAAAGTGACAGG - Intergenic
922520100 1:226242790-226242812 GAGGAGAAGGAGGAAGTGGAGGG - Intronic
922546238 1:226459351-226459373 TAGAAAAAGCAGGAAGAAGAAGG + Intergenic
923102420 1:230827031-230827053 GGGAAGACGCAGGGAGTGGCAGG - Intergenic
923329267 1:232907481-232907503 AAGAAGAAGAAGTAAGGGGCTGG + Intergenic
923724912 1:236497358-236497380 TAAATGAAGCAGAAAGAGGCCGG - Intergenic
924078672 1:240369143-240369165 TAGAAAAGGCAGGAGGTGGAGGG - Intronic
924604151 1:245517766-245517788 AAGAATGAGCAGGAGGTGGCTGG + Intronic
924748161 1:246858253-246858275 TAGAAGAAGAAGGTGTTGGCCGG - Intronic
1064989034 10:21239719-21239741 TAAAAAATGCAGTAAGTGGCAGG + Intergenic
1065393509 10:25209147-25209169 TAAAGAAAACAGGAAGTGGCTGG - Intronic
1065690687 10:28330487-28330509 TAAAAAAAGCAGGAAGAGACTGG + Intronic
1066535186 10:36383495-36383517 TACCAGATGCAGGAAGTGGGAGG - Intergenic
1066631498 10:37463022-37463044 TAAAACAAGCAGGAGGCGGCTGG - Intergenic
1067691894 10:48507480-48507502 GAGAAGAAACAGGAAATGCCAGG + Intronic
1067844119 10:49705458-49705480 TACAAGAAACAGGAATTGACTGG + Intronic
1067902330 10:50255238-50255260 AAGAAGAAGTAGGAAGGGGGAGG + Intergenic
1068264468 10:54628245-54628267 GAGAAGAAGCAGGAAGATGTAGG + Intronic
1069065016 10:63933313-63933335 TAGAAGAGACAGGAAGGGGTAGG - Intergenic
1069149518 10:64940356-64940378 AAGACAAAGCAGGAAGTGTCTGG - Intergenic
1069605291 10:69735224-69735246 GACCAGGAGCAGGAAGTGGCTGG + Intergenic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1071618693 10:87098215-87098237 TATTAGAAGCAGGGAGTGGCTGG + Intronic
1072033470 10:91542823-91542845 TTTAAGAAGCAGAATGTGGCCGG + Intergenic
1072918323 10:99554294-99554316 AAGAAGGAGTAGGAGGTGGCTGG - Intergenic
1073324315 10:102633760-102633782 TAGAAGAGGGATGTAGTGGCAGG - Intergenic
1073442622 10:103561557-103561579 TAGAATACAGAGGAAGTGGCTGG - Intronic
1073763853 10:106660191-106660213 TAGCAAATCCAGGAAGTGGCAGG + Intronic
1073769124 10:106716045-106716067 TATAAAAAGAAAGAAGTGGCCGG - Intronic
1074167907 10:110902027-110902049 TAGGAAAAGTAGGAACTGGCAGG + Intronic
1075148042 10:119899992-119900014 GAGAAGCAGGAGGAAGGGGCAGG - Intronic
1075350828 10:121723665-121723687 GAGAAGAAGCAAGAACTGGCGGG + Intergenic
1075434178 10:122420475-122420497 AATATGAAGCAGGAAGTGGGTGG - Intronic
1076662497 10:132064920-132064942 TAGAAGAGGCAGGTTGTGGGGGG + Intergenic
1076864106 10:133159055-133159077 TGGAAGGAGGCGGAAGTGGCAGG - Intergenic
1077476026 11:2790917-2790939 TAAGAGAAGCAGGAAGCCGCTGG - Intronic
1078328245 11:10397834-10397856 GCCAAGAAGCAGGAAGGGGCTGG + Intronic
1078369622 11:10734197-10734219 TATAAGAAACAGAAAATGGCCGG + Intergenic
1079333417 11:19551691-19551713 GAGAGGAAGCAGGACGTGGCTGG - Intronic
1080886467 11:36372631-36372653 CAAGAGAAGCAGGGAGTGGCTGG + Intronic
1081558716 11:44192214-44192236 AAGAAGAAGCAGGAGAGGGCTGG - Intronic
1083158670 11:60841366-60841388 TAGAAGAAGAGGGACGTGGGAGG + Intergenic
1083655694 11:64228366-64228388 TTGAAAAAGGAGTAAGTGGCCGG + Intronic
1084601185 11:70146878-70146900 TAGAAAAAGCAGGCAGGGGAAGG - Intronic
1084639283 11:70414823-70414845 GAGAGGAAGCAGGATGCGGCGGG + Intronic
1085018904 11:73192710-73192732 CAGAGGAAGCAGGCACTGGCAGG - Intergenic
1085488012 11:76885063-76885085 TAGAAAAAGAAGGATCTGGCTGG - Intronic
1086453350 11:86938501-86938523 CAGGAGGAGCTGGAAGTGGCTGG + Intronic
1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG + Intergenic
1086945625 11:92841274-92841296 TAGAAGGAGCAGGAAATGAGAGG + Intronic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088707369 11:112475923-112475945 TAGAAGCAGCAGGAAGGGAGGGG - Intergenic
1089383895 11:118055694-118055716 TAGAAGAAGCAGCTATTGGGTGG - Intergenic
1089561446 11:119345344-119345366 GAGCAGAATCAGGGAGTGGCAGG - Intronic
1090168825 11:124580357-124580379 GAGAAGACGCAGGAAAGGGCAGG + Intergenic
1090281262 11:125458111-125458133 TAGCAGCGGCAGGAGGTGGCCGG - Intronic
1090595466 11:128316050-128316072 TACAGGAAGCAGGAAGTTCCTGG + Intergenic
1090742919 11:129682347-129682369 CACCAGAAGCAGGAAGAGGCAGG - Intergenic
1090940627 11:131385024-131385046 AAGAAGAAGCAGGAGGTACCCGG + Intronic
1091110387 11:132960979-132961001 TAGATTCAGCAGGAAGGGGCAGG - Intronic
1091283687 11:134396503-134396525 TAGCAGAGGCAGAAAGAGGCTGG - Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1092203804 12:6603512-6603534 TAGGACAGACAGGAAGTGGCAGG + Intronic
1092438409 12:8473288-8473310 TATAAGAAGTAGGAGCTGGCCGG - Intronic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1092818925 12:12335212-12335234 GTGAAGAAACAGGGAGTGGCGGG - Intronic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1093785967 12:23192660-23192682 TAGGGGAAGGAGGAAGAGGCAGG - Intergenic
1094586527 12:31782221-31782243 TGGAAGAAGATGCAAGTGGCTGG + Intergenic
1094693704 12:32795675-32795697 TAGAAGAAGCAGTGATGGGCTGG - Intronic
1095307281 12:40653010-40653032 TAGGAGAAGCAGGTTGGGGCAGG - Intergenic
1095582941 12:43820803-43820825 TATAAGAAGCATAAAGTGGCCGG + Intergenic
1096070842 12:48774730-48774752 TAGCAGCAGCAGGAAGATGCTGG + Exonic
1096815537 12:54199614-54199636 TAGTAAAAGAAGGAAGGGGCTGG + Intergenic
1097032495 12:56099778-56099800 TAGAAAAAGGAGGAGTTGGCTGG + Intronic
1097075053 12:56386822-56386844 TACAAGAAGCATGGTGTGGCTGG + Intergenic
1097341091 12:58439015-58439037 AAGAAGAAGGTGGAAGTGGAAGG + Intergenic
1097650656 12:62293255-62293277 TAGAAAAAGAAGGAAGTGAGAGG - Intronic
1100637274 12:96446830-96446852 TAGAAGAAACAGGAAGTAGAAGG - Intergenic
1101585561 12:106082628-106082650 TAGAATAAGCAGGAAATAGTTGG - Intronic
1101646962 12:106640254-106640276 TGGCAGAGGCAGGAAGTGGCTGG + Intronic
1102142641 12:110628257-110628279 TAGAAGAAGCAGGCTGAGTCTGG + Intronic
1102185755 12:110947220-110947242 AAGAAAAAGAAGGAAATGGCTGG - Intergenic
1102366928 12:112345638-112345660 TAGAAAGAACAGGAAGTAGCTGG + Intronic
1102799154 12:115716469-115716491 TAAAGGAAGCAGGAGGAGGCTGG + Intergenic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1103631845 12:122267829-122267851 TAGAAGATGCTGGAGGAGGCCGG - Intergenic
1104926378 12:132316112-132316134 AAGAAGAGGCAGGCAGAGGCAGG + Intronic
1105580342 13:21689890-21689912 TGGAAGAAGCAGGAAGAGCTTGG - Intronic
1105595950 13:21838185-21838207 TGCATGAAACAGGAAGTGGCTGG + Intergenic
1105711245 13:23011441-23011463 TAGAAGAAGCAGGAAAAGGAGGG + Intergenic
1107473562 13:40713308-40713330 TAAAAGAAGAAGGGGGTGGCTGG - Intergenic
1107526110 13:41233283-41233305 TAGAGGAAGTAGGAAGAGGGTGG + Intronic
1107596653 13:41970160-41970182 GAGAAGAAATAGGAAGTGGTAGG + Intergenic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1109109429 13:58297197-58297219 AAGAAGCAGAAGGAATTGGCTGG + Intergenic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1109641581 13:65198770-65198792 TAAAATAAGCAGGAAGAGGTAGG - Intergenic
1109874305 13:68379296-68379318 AAGAAGAGGCATGAAGTTGCAGG - Intergenic
1111647727 13:91051732-91051754 TAGAGGAAATAGGACGTGGCTGG - Intergenic
1112798800 13:103087932-103087954 CAGAAGATGAAGCAAGTGGCTGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113190338 13:107738467-107738489 TAGAAGAATGAGAAAGTGTCTGG - Intronic
1113566927 13:111324912-111324934 TAGAAGCCTCAGGAGGTGGCTGG + Intronic
1114423219 14:22601975-22601997 GTGAAGTTGCAGGAAGTGGCAGG - Intronic
1114526779 14:23371483-23371505 TAGAAGAAGCAGGTGGTGGCTGG - Intergenic
1115139958 14:30159473-30159495 TAGAAGATGGAGGAAGTGTTTGG - Intronic
1115476101 14:33814334-33814356 TAGAAAATGCAGGAAATGTCCGG + Intergenic
1117852584 14:59990868-59990890 TGGGAGAAGAAGGAAGTGTCAGG - Intronic
1118036358 14:61872587-61872609 GAGAAGAAACAGGAAGGGGCAGG - Intergenic
1118263018 14:64265826-64265848 TAAAAGAAGCAGGATGGTGCAGG + Intronic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1119770195 14:77215820-77215842 TAGAAGAAGTAGGAGGAGGGGGG - Intronic
1119962393 14:78874507-78874529 TAGGAGTTGCAGGAAGTGGTGGG - Intronic
1121512845 14:94525432-94525454 GAGAAGAGGAAGGAAGGGGCTGG + Intergenic
1122229998 14:100301803-100301825 TATTAGAAGCAGGAAGTGCCGGG - Intronic
1122309615 14:100786213-100786235 GAGAGGAAACAGGAAGGGGCAGG + Intergenic
1122552766 14:102558917-102558939 AAAAAGAAGCAGGCAGTGGGTGG - Intergenic
1122910525 14:104825803-104825825 GAGCAGAGGCAGGAAATGGCTGG + Intergenic
1122964632 14:105116671-105116693 TTCAAGAAGCTGGAAGTGGCCGG - Intergenic
1122987316 14:105218457-105218479 CAGACGAAGCTGGAGGTGGCTGG - Intronic
1202844535 14_GL000009v2_random:156042-156064 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1202913926 14_GL000194v1_random:146283-146305 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1202878728 14_KI270722v1_random:36419-36441 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
1124463111 15:29911347-29911369 CAGCAGAAGAAGGAAGAGGCAGG + Intronic
1125429192 15:39579366-39579388 TAGAAGGAGAAGGAAGGGGAGGG + Intergenic
1125441909 15:39711981-39712003 TAGAAGAAGTAGGAATGGGCTGG - Intronic
1125713238 15:41804134-41804156 AAAAATAAGCAGAAAGTGGCCGG - Intronic
1125845731 15:42851339-42851361 CAGAAGAAGCAGGCAGGGGTCGG + Intronic
1126212279 15:46113363-46113385 GAGTATAAGCAGGAAGAGGCTGG - Intergenic
1126933165 15:53677214-53677236 TTTAAGAAGCAAGAATTGGCTGG - Intronic
1127162761 15:56207267-56207289 TAGAAGGAGGAGGAAATGGGGGG + Intronic
1127210255 15:56766927-56766949 TACAAGACTCAGGAAGTAGCCGG + Intronic
1127817166 15:62621133-62621155 TATAAGAAGCAGGTTTTGGCCGG - Intronic
1128267678 15:66280849-66280871 TAGAAGCAGCCTGGAGTGGCTGG - Intergenic
1128392974 15:67195585-67195607 TAGCAGAGGCAAGAGGTGGCAGG - Intergenic
1128727792 15:70000594-70000616 GAGAAGAAGCAAGAAGAGCCAGG + Intergenic
1129931152 15:79412165-79412187 CAGTAGAGGAAGGAAGTGGCTGG - Intronic
1130693839 15:86110507-86110529 GAGAAGGAGAAGGAAGAGGCGGG + Intergenic
1131125034 15:89852754-89852776 TAGAAGGAGCAGGAACTGTGGGG - Intronic
1131140938 15:89976699-89976721 TATAAGAAGCAAGATGAGGCTGG + Intergenic
1132890906 16:2204207-2204229 AAGAAGAAGTGGGAAGAGGCCGG + Intergenic
1133156839 16:3881337-3881359 TGGTCGAGGCAGGAAGTGGCAGG + Intergenic
1133660477 16:7911549-7911571 GAGAAGGAGCAGGAAATGGAGGG + Intergenic
1134227747 16:12404494-12404516 CAGGAGAAGCAGGAAGCAGCTGG - Intronic
1134324251 16:13192627-13192649 TAGAAGAAACAGGCCGAGGCGGG + Intronic
1134747044 16:16596457-16596479 CAGAAGAGACAGGAAGTAGCTGG + Intergenic
1134998432 16:18757203-18757225 CAGAAGAGACAGGAAGTAGCTGG - Intergenic
1135175508 16:20224524-20224546 TATAAGAAGAAGAAAGTGGACGG + Intergenic
1135235183 16:20748695-20748717 GAGAACCAGCAAGAAGTGGCTGG - Intronic
1135963420 16:27016402-27016424 AAGAAGAAGGAGGAAGTGGGGGG - Intergenic
1136251175 16:29006212-29006234 TAGGAGAAGCCTGAAGTGTCCGG - Intergenic
1136749379 16:32619345-32619367 TAGGAGAAGGAGGACGTGTCAGG + Intergenic
1136998932 16:35211689-35211711 GAGAAGAAACAGGAGGTGTCGGG + Intergenic
1138062500 16:53906723-53906745 TGGTAGAAGCAGGAAGATGCAGG + Intronic
1138665537 16:58564675-58564697 TAGAAGTGGCAAGAATTGGCCGG + Intronic
1139161418 16:64515072-64515094 TATAAGAAGTAGGAAATTGCAGG - Intergenic
1139953091 16:70681316-70681338 GAAATGGAGCAGGAAGTGGCAGG + Intronic
1140288534 16:73627961-73627983 GAGAAGTAGCATGAAGAGGCAGG + Intergenic
1140799242 16:78470194-78470216 TGGAAGAAGTAGGAATTTGCAGG + Intronic
1141065856 16:80913068-80913090 TTGGAGAAGCAGGAAGAGCCAGG - Intergenic
1141635655 16:85312676-85312698 CAGAAGAAGCAGGGAGGGGGAGG + Intergenic
1141716455 16:85729806-85729828 TATCAGAAGCTGGAAGAGGCAGG + Intronic
1203051511 16_KI270728v1_random:878559-878581 TAGGAGAAGGAGGACGTGTCAGG + Intergenic
1142644784 17:1304711-1304733 TGGAGGAAGCAGGAGGGGGCAGG + Intergenic
1143236063 17:5402018-5402040 TAGAAGAACCAAGAAAAGGCTGG + Intronic
1143275226 17:5705384-5705406 AAGAAGACGCAGGAGGTGGCAGG - Intergenic
1143564098 17:7711213-7711235 TAGAAAAATCAGGAAGGAGCTGG - Exonic
1144201854 17:12949054-12949076 GAAAAGAAGCAGGCAGTTGCGGG + Intronic
1146266834 17:31458419-31458441 CAAAAGCAGCAGGAAGGGGCTGG - Intronic
1147775511 17:42898097-42898119 TGGAGGAAGCAGAAAGGGGCTGG + Intergenic
1148073617 17:44922704-44922726 TGGAAGAGGCAGGATGAGGCAGG + Intergenic
1148842152 17:50505986-50506008 GAGAGGAAGCAGGAAAGGGCTGG - Intergenic
1149697453 17:58627472-58627494 TAAAAGAAGTGGGAAATGGCCGG + Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1151189770 17:72389669-72389691 TAGAAAAAGCTGGAAAAGGCAGG - Intergenic
1152053615 17:78002932-78002954 TAGAAGAAAAAGGAAGAGTCAGG + Intergenic
1152268359 17:79309396-79309418 GAGAAGCAGCAGGAGGGGGCGGG - Intronic
1152329287 17:79662416-79662438 TAGAATAAACAGGAAGCAGCCGG - Intergenic
1152946148 17:83198662-83198684 TAGAAGAGGCAAGAAGAAGCGGG - Intergenic
1153051240 18:905213-905235 TATAGCAAGCAAGAAGTGGCAGG + Exonic
1153568994 18:6449425-6449447 GAGCAGAGGCAGGAAGTGGGTGG - Intergenic
1153655633 18:7279805-7279827 TGAAAGAAGCAGAAAGTTGCCGG + Intergenic
1153716580 18:7855920-7855942 TAGAAAAAGCAGAAGGTGCCTGG + Intronic
1155099583 18:22596142-22596164 AAGAAGCAGCAAGAAGTGGGTGG - Intergenic
1156260203 18:35439248-35439270 TATAAGAAGAGGGAAGAGGCCGG + Intergenic
1157285936 18:46377476-46377498 TAGGAGGGGCAGCAAGTGGCTGG + Intronic
1157382022 18:47227170-47227192 GAGAAGGAGGAGGAAGAGGCAGG - Intronic
1157990377 18:52488730-52488752 TAGAAACAGCAAGATGTGGCAGG - Intronic
1157990396 18:52488943-52488965 GAGAAGAAGGGGGAAGAGGCGGG - Intronic
1158390025 18:57037307-57037329 TAGAAGCAGGAGGAAGTGTGGGG + Intergenic
1159557423 18:69959948-69959970 TAGAAAATGCAGGCAATGGCTGG + Intronic
1159612988 18:70546931-70546953 AAGAAAAAGCAGGAAGAGCCTGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1161036964 19:2090294-2090316 GAGAAGAAAAAGGAAGTGGTCGG - Intronic
1161080897 19:2309636-2309658 TAGAAGATGCAGTGAGGGGCCGG - Intronic
1161112678 19:2478937-2478959 TGGGAGAAGTAGGAGGTGGCTGG - Intergenic
1161113429 19:2482646-2482668 TATAAAAAGCAGATAGTGGCTGG - Intergenic
1161238762 19:3210471-3210493 GAGAAGAAGCAGGGAGAGGTGGG + Intergenic
1161995782 19:7710454-7710476 AAAAAGAATCAGGGAGTGGCTGG + Intergenic
1162085142 19:8244192-8244214 CAGAAAAGGCAGGAAATGGCTGG + Intronic
1162230361 19:9260907-9260929 TAGAAAAGGCAGCAAGGGGCCGG - Intergenic
1162876549 19:13624904-13624926 TATAAGAAGCATCAAGAGGCCGG + Intergenic
1163809104 19:19419310-19419332 TACGAGATGCAGGAAGGGGCTGG - Intronic
1163851646 19:19667788-19667810 AAAAAGAAGCAGGAGGCGGCTGG + Intergenic
1164273822 19:23699491-23699513 GAGAAAAAGCTGGCAGTGGCAGG + Intergenic
1164428703 19:28168084-28168106 TAGATGAAGTAAGAAGTGACTGG + Intergenic
1164436576 19:28235794-28235816 TTGAAGAAGAAGTAAGTGGGTGG + Intergenic
1165675037 19:37715200-37715222 TTTAAGAAACAGAAAGTGGCTGG - Intronic
1166944684 19:46389808-46389830 AAGCAGGAGCAGGAAGGGGCAGG - Intronic
1167083538 19:47293567-47293589 AAAATGAAGGAGGAAGTGGCTGG - Intronic
1167138322 19:47631943-47631965 TAAAAGAAGCAGGGAAAGGCCGG - Intronic
1167655257 19:50759519-50759541 AAGAAGAGGCAGGATTTGGCAGG - Intergenic
1167657059 19:50771750-50771772 AAGAAGAGGCAGGATTTGGCAGG - Intergenic
1202654351 1_KI270708v1_random:5453-5475 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
925449063 2:3952813-3952835 TAGAAAAAGCACTAACTGGCCGG - Intergenic
925995565 2:9289959-9289981 GAGAAGGCGGAGGAAGTGGCAGG + Intronic
926420503 2:12692101-12692123 TACCAGAAACAGGAAGAGGCAGG - Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
927205584 2:20608276-20608298 TAGAAGTAGCAGAAACAGGCCGG + Intronic
927629958 2:24764536-24764558 TAGAAGTAGAAGGAACTGGAAGG + Intronic
927693909 2:25227378-25227400 TAGAAAAAGCAGGAATTGGTAGG - Intergenic
927725355 2:25418002-25418024 TGGAAGAAGCATGTAATGGCTGG + Intronic
927831413 2:26353982-26354004 TAGAAGCACAAGGAAGTGGCGGG + Intronic
928387321 2:30881480-30881502 TACACGAAGGAGGAAGGGGCCGG + Intergenic
931566321 2:63619707-63619729 TACAAGGATTAGGAAGTGGCTGG + Intronic
931607255 2:64065011-64065033 TAAAAGCAGCAGGCAGAGGCCGG + Intergenic
931740132 2:65234724-65234746 TAAGAGAAGCTGGAGGTGGCAGG - Intronic
932086736 2:68769316-68769338 TTTAAGAAGCAGGCACTGGCTGG + Intronic
932736361 2:74257314-74257336 GAGAAAAAGCAGGAATTGACAGG + Intronic
934737090 2:96695119-96695141 CTGAAGAAGCAGGAAGTGCCTGG - Intergenic
934994934 2:98949265-98949287 TTGAAGAAGCTGGAATTTGCAGG + Intergenic
935837614 2:107072617-107072639 TATAAAAGTCAGGAAGTGGCAGG + Intergenic
936590546 2:113799754-113799776 ACAAAGAAGCAGGAAGTGGGGGG - Intergenic
936944434 2:117917807-117917829 CATAAGAAGCAAGAAGTGGGAGG + Exonic
937426796 2:121806654-121806676 TTGAAGATGGAGGAAGGGGCTGG + Intergenic
937918809 2:127115553-127115575 TAAAGGAAGCAGGCAGTGACTGG - Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938629803 2:133154136-133154158 TTCAAGAAGGAGGAACTGGCCGG - Intronic
938701741 2:133885716-133885738 TACCAGAAGCTGGAAGAGGCAGG + Intergenic
941029926 2:160499585-160499607 TGGAAGAAGCAGGCAATGGAAGG - Intergenic
941236161 2:162976940-162976962 TAGAGGAAGCAGGAGATGGGAGG - Intergenic
941831332 2:169963446-169963468 TAGAAAAAGGATGAAGTGGTAGG - Intronic
942104973 2:172624695-172624717 GAGAATAAGAAGGAAGGGGCAGG + Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942349238 2:175035755-175035777 TCGAAGAAGCCGCAAGTGGTAGG + Intergenic
942635305 2:177997785-177997807 CAGAAGAAGCAGAAAATGGAGGG - Intronic
942743099 2:179202258-179202280 GAGAAAAAGCAGAAAGTAGCGGG - Intronic
943018173 2:182540066-182540088 TGAAAGAAGTAGGAAGTGGCTGG + Intergenic
943360277 2:186911116-186911138 TACGTGATGCAGGAAGTGGCAGG + Intergenic
943398815 2:187377973-187377995 TAGTAGAAGAAGGAAGTTGGAGG + Intronic
943503415 2:188721596-188721618 TAGAGGAAGCAGGATTGGGCAGG - Intergenic
945061795 2:205915812-205915834 TTGAAGATGGAGGAAGGGGCAGG - Intergenic
945963860 2:216164669-216164691 TAGAAGAAGAGGGGAGAGGCAGG + Intronic
946131623 2:217611173-217611195 TAGAAGGAGCATGAAGTCACAGG + Intronic
946135936 2:217646913-217646935 TAGGAGCAGCAGGAAGTAGCAGG - Intronic
946573995 2:221054335-221054357 TAGAAGAACCTGCAAGTGTCTGG - Intergenic
947142145 2:227029288-227029310 AAGAGGAAGGAGGAAGGGGCTGG - Intronic
947534604 2:230933068-230933090 GGGAAGAGGCAGGAAGGGGCAGG - Intronic
948596242 2:239081558-239081580 TAGAGGAAGTAGGAAATGACAGG - Intronic
1168838195 20:891693-891715 GAGATGAAGGAGGAAGTGGCTGG - Intronic
1169347314 20:4839006-4839028 TTGAACAAACAGGAAGTGCCAGG - Intergenic
1169548248 20:6673337-6673359 CAGAAGAAGAAGGAAGTTGGGGG - Intergenic
1170045877 20:12084942-12084964 TTGAAGATGGAGGAAGGGGCCGG - Intergenic
1170337761 20:15289558-15289580 GTGAAGAACAAGGAAGTGGCAGG + Intronic
1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG + Intergenic
1172299200 20:33836935-33836957 TAGAAGCAGAAGGAAGAGTCTGG + Intronic
1172470829 20:35193675-35193697 TAGAAGAAGCAGGTTTTGGTGGG + Intergenic
1173875502 20:46368087-46368109 CAGAGGAAGCAGGAAGAGTCAGG - Intronic
1174956120 20:55100443-55100465 TAGAAAAAGCAGGCAGAGGAAGG - Intergenic
1175081557 20:56424878-56424900 TAGATGAGGGAGGAGGTGGCTGG + Intronic
1175152723 20:56947665-56947687 TGGAAGTAGGAGGAAGGGGCTGG + Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176208263 20:63902971-63902993 TAAAAAAAACAGGATGTGGCAGG - Intronic
1176514441 21:7773757-7773779 TAGAGGCAGCATGAAGTGGGGGG + Intergenic
1176633281 21:9160958-9160980 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1177016220 21:15791055-15791077 TAGAAGAAGAACTAAGTGGTCGG + Intronic
1177163795 21:17577822-17577844 TAGGAGAAGCAGAGAGTGCCAGG - Intronic
1177996240 21:28102905-28102927 TGAAAGAAGCAGGAATTGACTGG - Intergenic
1178648554 21:34404281-34404303 TAGAGGCAGCATGAAGTGGGGGG + Intronic
1178976217 21:37223292-37223314 AAGAAGTGGAAGGAAGTGGCCGG + Intergenic
1179257589 21:39730133-39730155 TAGCAGAAGCAGGAAGAAGCAGG - Intergenic
1179334860 21:40441176-40441198 TCCAAGAAGGAGGAAGTGCCAGG + Intronic
1179727457 21:43348403-43348425 TGGCAGAGGCAGGAAGGGGCTGG - Intergenic
1180389144 22:12208972-12208994 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1180416797 22:12725499-12725521 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
1180981334 22:19879508-19879530 TGGAAGAAGCTGGAAGAGGATGG + Intronic
1181921898 22:26327096-26327118 CAGCAGAAGCTGGCAGTGGCTGG - Intronic
1182965906 22:34520720-34520742 TAGGAGAAGCCCGAAGTGTCCGG - Intergenic
1183266921 22:36833582-36833604 CAGAAATAGCAGTAAGTGGCAGG + Intergenic
1183772347 22:39938050-39938072 CATAAGAAGAAGGAAGTGGCTGG + Intronic
1184309837 22:43634008-43634030 GAGGAGAAGCAGGAAGTGAGGGG + Intronic
1184977883 22:48075960-48075982 TAGAATAAACAGGCAGGGGCAGG + Intergenic
1185093917 22:48795517-48795539 TGGTAGAAGGAGGAAGGGGCAGG - Intronic
1185376920 22:50486965-50486987 TAGAAGAGGGCGGGAGTGGCTGG - Intronic
949890720 3:8731993-8732015 AAGAAGAAAGAGGAAGGGGCAGG - Intronic
950768349 3:15290914-15290936 AGGCAGAAACAGGAAGTGGCTGG + Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
953041748 3:39261708-39261730 TAGAATAAGCATGAAGTGAGTGG + Intergenic
953170139 3:40499778-40499800 AAGAAGAAACAGGATGTGCCTGG - Intergenic
954007713 3:47605473-47605495 TGGAAGAAGCCAGATGTGGCCGG + Intronic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
955107187 3:55909451-55909473 TTGAATAAGCAGGGAGTAGCTGG + Intronic
955902668 3:63774093-63774115 TATAAGAAGGAGAAACTGGCCGG + Intergenic
956313961 3:67913835-67913857 TAGAAGAAGGAGGAAAAGGAGGG - Intergenic
956874146 3:73445334-73445356 TAGGAGAAGCAGGAGTTGGATGG + Intronic
956983010 3:74661851-74661873 TAGAGAAAACAGGAAGTGTCAGG - Intergenic
957909103 3:86598854-86598876 TATAAGTAGAAGGAAGTTGCAGG - Intergenic
960018915 3:112926961-112926983 TAGAAGAAGAAGTATGTGGAGGG + Intronic
960266384 3:115625140-115625162 GAGAAGGAGCAGGAAGAGGATGG + Intronic
960374415 3:116880888-116880910 TAGAAGAAGGAGGACCTGGAGGG - Intronic
960739282 3:120815109-120815131 TGGAAGAAGCAGGATTGGGCAGG - Intergenic
960963669 3:123090033-123090055 GAGAAGCAGCAGCCAGTGGCTGG + Intronic
961096980 3:124165900-124165922 GTGAACAAGCAGGAAGTGGTAGG - Intronic
961494054 3:127277853-127277875 TCCAAGAAGCAGGAAGTAGAGGG - Intergenic
961595268 3:128011059-128011081 TAAAGGAAGTAGGAAGTGGGAGG - Intergenic
962149419 3:132877205-132877227 TTGATGAAGCAGAAAGTGGGAGG - Intergenic
963111316 3:141690557-141690579 TAGAAGATGAGGGAAGTGGAAGG - Intergenic
963504368 3:146165027-146165049 CAGAAGAAACAGGAAGTGCAAGG + Intergenic
963570282 3:146986168-146986190 TAGAAATAGCTGGAAGTGGATGG - Intergenic
963909355 3:150802141-150802163 TAGAAGTAGATGGAAGTGGAAGG + Intergenic
964378391 3:156072285-156072307 TCGAAGAATCAGGAAGTTACTGG - Intronic
965352069 3:167625786-167625808 TAGAAAAATCAGGGAATGGCTGG + Intronic
966040815 3:175485669-175485691 TAGAAAAAGCAGGAAGATGAAGG - Intronic
966072865 3:175900570-175900592 TGAAAGAAAAAGGAAGTGGCTGG + Intergenic
966532212 3:180993627-180993649 AAGAGCAAGCAGGAAGTGGAAGG + Intergenic
967014620 3:185470505-185470527 GAGTAGAAGCAGGAAGAGACGGG - Intronic
967910753 3:194540768-194540790 TTCAGGAAGGAGGAAGTGGCTGG - Intergenic
968942072 4:3644091-3644113 TGGAAGAGGCAGGAAGAGGAAGG + Intergenic
970139059 4:12960211-12960233 TAAACGAAGCATGAAGTGGGAGG + Intergenic
970651975 4:18188856-18188878 AAGAAGGAGGAGGAAGTGCCAGG - Intergenic
970656514 4:18236385-18236407 TACCAGAAGCTGGAAGAGGCAGG + Intergenic
970768849 4:19585533-19585555 TACAAGATGCAGGTACTGGCAGG - Intergenic
970866937 4:20770092-20770114 CAGAAGAAGCAGGCTGTGGGAGG - Intronic
972300942 4:37785090-37785112 GAGAAGGTGCAGGAACTGGCTGG - Intergenic
972683571 4:41330150-41330172 TAAGAGAAGCAGGAAGTATCTGG + Intergenic
972998364 4:44912614-44912636 GAGAAAAAGCATGAACTGGCAGG + Intergenic
973282658 4:48376155-48376177 TAGAATATGAAGGAAGGGGCTGG + Intronic
974099177 4:57397948-57397970 TGGAAGTGGTAGGAAGTGGCTGG + Intergenic
974618911 4:64330184-64330206 TAGAAGAACCGTGAAGTGTCTGG + Intronic
974975016 4:68881023-68881045 CAGAAGAAGAAACAAGTGGCTGG - Intergenic
975838835 4:78453250-78453272 AAGAAAAAGGAGGCAGTGGCAGG + Intronic
976621020 4:87127457-87127479 AAGAAAGAGCAAGAAGTGGCTGG - Intronic
977147531 4:93463691-93463713 TAGAACAAGCAGGTGCTGGCTGG + Intronic
977461642 4:97333143-97333165 GAGAAGATACCGGAAGTGGCTGG + Intronic
977731855 4:100363263-100363285 CAGAGGAAGCTGGAAGAGGCAGG - Intergenic
978119872 4:105065524-105065546 AAGATGAAGAAGGAAGGGGCAGG + Intergenic
978682765 4:111402368-111402390 GAGAAGGAGCAGGAAGAGGAGGG + Intergenic
979282670 4:118885180-118885202 TGGAAGAAGTAGGTAGTGGGAGG + Intronic
979744564 4:124195626-124195648 TAGAACAAGTAGGAAGTAGGCGG - Intergenic
981188154 4:141829931-141829953 TAGCAGAAGGAGGAAGAGGAAGG - Intergenic
981559634 4:146033061-146033083 TAGAAGAAGCAGCAAGGCCCTGG + Intergenic
982393396 4:154890823-154890845 CAGAGAAAGCAGGAAGTAGCAGG - Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
983557767 4:169073757-169073779 TATAAAAAGCAGAATGTGGCCGG + Intergenic
983738222 4:171090733-171090755 TAGGATAAGCAGGAGGGGGCTGG - Intergenic
984436641 4:179718472-179718494 TAGAAAAAGCAGGCAGTAGAAGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985472578 5:54686-54708 TCCCAGAAGCCGGAAGTGGCCGG - Intergenic
985756189 5:1719930-1719952 CAGCAGGAGCAGGATGTGGCAGG + Intergenic
985926929 5:3026275-3026297 GAGGAGAAGCAGGGAGAGGCAGG - Intergenic
986293758 5:6420756-6420778 GAGAAGCAGTAGGAAGTGGCGGG - Intergenic
986812835 5:11378151-11378173 TGGTGGAAGCAGGAAATGGCTGG + Intronic
986989107 5:13531201-13531223 AAGAAGAAGTAGGAAGGGGAGGG - Intergenic
987231319 5:15896595-15896617 CAGAGGAAGGAGGAACTGGCAGG - Intronic
987384672 5:17318001-17318023 GAGAAGAAGAAGGCAGTGTCAGG + Intergenic
987944980 5:24594651-24594673 GAGAACAAGTAGGAAGTTGCTGG - Intronic
988031622 5:25770670-25770692 TAGAAGAAACAGAAAGTTGAGGG + Intergenic
988991099 5:36671909-36671931 GAGAGGAAGCAGGAAGGTGCTGG - Intronic
990874498 5:60468926-60468948 TTGAAGATGCAGGAAATGGTGGG - Intronic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992418626 5:76578606-76578628 TAGAAAAAGAATGATGTGGCCGG - Intronic
992423195 5:76627219-76627241 GGGAAGAAGGAGGAAGTGGTCGG + Intronic
992865638 5:80954454-80954476 CAGGAGAATCAGGAAGGGGCTGG + Intergenic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
992971390 5:82062609-82062631 AAGAAGAAGCAGGATGTGAATGG + Intronic
994616833 5:102114711-102114733 TAGAAGCAGCAGGAGGTGGAGGG + Intergenic
994626764 5:102229890-102229912 TTGAAGATGGAGGAAGTGGGGGG + Intergenic
994743459 5:103649473-103649495 TAGAGGGAGCAGCAAGTGGAAGG + Intergenic
996285620 5:121787880-121787902 TAGTGGAAGCACGAAGTGGCTGG + Intergenic
999036084 5:148351389-148351411 TAGAAGAATAAGTAAGTGGTAGG + Intergenic
999157128 5:149466079-149466101 TAAAAGATGCAGGAGTTGGCCGG - Intergenic
999376614 5:151091170-151091192 AAGAAGAAGCAGAAAGGAGCTGG - Intronic
999435021 5:151556999-151557021 TAGAGAAAGCAGGAAGTAGCTGG - Intronic
999469920 5:151844964-151844986 GAGAGGAAGCAAGAAGTGGGTGG + Intronic
1000011054 5:157233238-157233260 GACAAGGAGCAGAAAGTGGCAGG - Intronic
1000171326 5:158705731-158705753 AGGAAGGAGCAGGAAGTGGTTGG - Intronic
1000762421 5:165242602-165242624 TAGAAGAAGCTGGAAGCTACAGG + Intergenic
1000939116 5:167338706-167338728 TCAAAGAAGCAGGAACTGGGTGG + Intronic
1001240619 5:170067267-170067289 AGGCAGAAGCAGGAAGTGTCAGG - Intronic
1002605514 5:180380688-180380710 GAGAATGAGCAGGAAGGGGCCGG - Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003194873 6:3905829-3905851 AACAAGAAGCTGGATGTGGCTGG + Intergenic
1006174996 6:32116343-32116365 GAGAAGCAGCAGGAAGTAGGTGG - Intronic
1006366887 6:33621318-33621340 TAGAAGGAGCAGGAAGTCTGGGG - Exonic
1006508811 6:34510396-34510418 AAGAAGAGGCAGGCAGGGGCTGG - Intronic
1006510180 6:34517231-34517253 TAGAAGGAGCGGGAAGAGGCTGG - Intronic
1006922807 6:37637507-37637529 TGGCAGGGGCAGGAAGTGGCAGG + Intronic
1007664742 6:43507542-43507564 GAGGAGGAGGAGGAAGTGGCAGG - Exonic
1007728046 6:43928670-43928692 TGCAAGTAGAAGGAAGTGGCTGG - Intergenic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008246760 6:49184687-49184709 AAGAAGAAGAAGGAGGTGGGGGG - Intergenic
1008289493 6:49696302-49696324 TAGGAGTAGCAGGTTGTGGCAGG + Intronic
1009836638 6:69009539-69009561 TTGGAGAGACAGGAAGTGGCTGG + Intronic
1010037559 6:71343930-71343952 AGGAGGGAGCAGGAAGTGGCAGG + Intergenic
1011115142 6:83881471-83881493 TACAAGAAGCAGTATGAGGCTGG - Intronic
1011325754 6:86148863-86148885 CAGAAGAAGATGTAAGTGGCTGG - Intergenic
1011431809 6:87295271-87295293 TACATGAAGAAGGAAGTGCCTGG + Intronic
1011798592 6:90983753-90983775 CACCAGAAGCAGGAAGGGGCAGG - Intergenic
1013693149 6:112668446-112668468 GAGAAGAAGCCTGAAGTGGGTGG - Intergenic
1013715150 6:112951141-112951163 TAGAAATAGGAGGAACTGGCCGG - Intergenic
1015130272 6:129801888-129801910 TGACAGAACCAGGAAGTGGCAGG + Intergenic
1015616188 6:135077993-135078015 TAGAAGATGCTGGAGGTGCCAGG + Intronic
1015937883 6:138420769-138420791 AAGAGGAAGCAGGACGAGGCAGG - Exonic
1015950678 6:138549490-138549512 CAGCAGAAGCTGGAAGAGGCAGG + Intronic
1016808217 6:148234527-148234549 AAGAAGAAGGAGGAACTGGCCGG + Intergenic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1017019783 6:150130866-150130888 TGGGAGGAGCAGGAAGAGGCTGG + Intergenic
1017589190 6:155960140-155960162 CAGAAGCAGCAGGAAGAGACAGG - Intergenic
1018058227 6:160070527-160070549 GAGAAGAGGTAGGAAGTGCCAGG + Intronic
1018773920 6:166997572-166997594 TGGAAGAGGTAGGAAGAGGCTGG - Intergenic
1019322777 7:423104-423126 TAGGAGAAGCACGAAGGGGTGGG + Intergenic
1019504099 7:1382008-1382030 AAGCAGAAGCTGGAAGTGGGGGG - Intergenic
1019520461 7:1458608-1458630 TGGGAGCAGCAGGAGGTGGCAGG - Intronic
1020144446 7:5631982-5632004 CAGAAGATGCAGAGAGTGGCTGG + Intronic
1020811643 7:12856224-12856246 CAAAAGAAGGAGGAAGTGGAGGG + Intergenic
1021178601 7:17479634-17479656 TACAAGAAGCTGGAAAAGGCAGG + Intergenic
1021628082 7:22614541-22614563 TAGAAGAAGCAGGAAGAAAGTGG - Intronic
1021628876 7:22623914-22623936 CAGCAGAAGTAGGAAGGGGCAGG + Intronic
1021922302 7:25497531-25497553 TGGAAGAAGCTGGGAGTGGCAGG - Intergenic
1021951914 7:25783280-25783302 TAGGAGAAGCAGCAACTGGAAGG - Intergenic
1023026590 7:36056396-36056418 GAGAAGAAGCAGGAGGAAGCAGG + Intergenic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023225144 7:37961293-37961315 CAGTAAAAGCAGGAGGTGGCTGG - Intronic
1023504417 7:40885334-40885356 TAAAAGAAGGAAGAAGTGGTGGG - Intergenic
1023725397 7:43137844-43137866 TAAAGAAAGCAGAAAGTGGCTGG - Intronic
1024117424 7:46207275-46207297 AAGATGGAGCAGGAAGTGCCTGG + Intergenic
1025797791 7:64756172-64756194 TAGAAAAAGCAGGAAGGAGGAGG - Intergenic
1025820164 7:64955389-64955411 TAGAGGAAGATGCAAGTGGCTGG + Intergenic
1026104169 7:67407900-67407922 CAGAAGGAGAAGGAAGTGGGAGG - Intergenic
1026205746 7:68255695-68255717 GAGAAGAAGGAGGAAGAGGTGGG - Intergenic
1026276909 7:68887708-68887730 TAGAAACAGCAGGAAATGACTGG + Intergenic
1027416617 7:77980899-77980921 TGGAATGAGCAGGAAGTGGGGGG + Intergenic
1027783348 7:82548142-82548164 TAAAAGCAACAGGAAGTGGAAGG + Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028544783 7:91985941-91985963 TAGAAAAAGGGGGAATTGGCTGG - Intronic
1030020641 7:105272145-105272167 TGGAAGAACCATGAAGTGGTGGG - Intronic
1030757011 7:113298978-113299000 TAGAAGAAACAGAAAGTGTCAGG + Intergenic
1030873435 7:114785229-114785251 TAACAGAAGCAGGAAATGCCAGG - Intergenic
1031555340 7:123168271-123168293 TAGAAAAGGAAGCAAGTGGCAGG + Intronic
1031801075 7:126246629-126246651 TACCAGAAGCTGGAAATGGCTGG - Intergenic
1031877116 7:127154289-127154311 TGGAAGTAGCAGGAAGCAGCTGG - Intronic
1032017435 7:128388994-128389016 TAGAAGAGGCTGCATGTGGCTGG + Intergenic
1032306901 7:130742448-130742470 TAGAAGAAGCAGGATATAGGAGG + Intergenic
1032525260 7:132575211-132575233 TGGAGGAGGTAGGAAGTGGCTGG - Intronic
1032834362 7:135659682-135659704 CAGAAAAACCAGGAAGTGGGTGG + Intergenic
1033218621 7:139512782-139512804 TAGAAGAAGCAGAAAGGGCTGGG - Intergenic
1033305379 7:140221708-140221730 TTGAAGGCTCAGGAAGTGGCTGG - Intergenic
1033539107 7:142339373-142339395 TAGAAGCAGCAGAAAGTGCCTGG - Intergenic
1033543307 7:142376643-142376665 TAGAAGCAGCAGGGAGTGCCTGG - Intergenic
1033598087 7:142870682-142870704 TAGAGTAAGCAGGGAGTGGTGGG + Exonic
1034736843 7:153437136-153437158 TAGAAGTAGCAGGAAGACCCTGG - Intergenic
1035206675 7:157298163-157298185 TAGAAGAAGAAGGAAATGGCTGG + Intergenic
1035276390 7:157750482-157750504 TATGAGAGGCAGGAAGTGGCAGG + Intronic
1035678803 8:1472517-1472539 GAGATGAAGCAGGAAATGTCAGG + Intergenic
1036053189 8:5223628-5223650 TAGAAAATACAGAAAGTGGCTGG + Intergenic
1036670615 8:10783484-10783506 TTGAAGGAGCAGCAACTGGCAGG - Intronic
1037121914 8:15298731-15298753 TAGGAGAAACAGGGAGTGGGAGG + Intergenic
1037748588 8:21665274-21665296 TAGAAGAAGGTGGAAGGAGCAGG + Intergenic
1038169441 8:25115721-25115743 TAGAAGGAGGAGGCAGAGGCCGG + Intergenic
1039252219 8:35679294-35679316 AAGAAAAAGCAGGAAGGGGTGGG + Intronic
1039553592 8:38460806-38460828 GAGGTGAAGCAGGAGGTGGCAGG - Intronic
1039888395 8:41668573-41668595 CAGAAGAAGCAGCAGATGGCCGG + Intronic
1040019130 8:42724680-42724702 TAGAAAACGCTGGAATTGGCCGG + Intronic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1042506967 8:69571194-69571216 GAGAAGAAGATGGAAGAGGCAGG + Intronic
1042598166 8:70471566-70471588 CAGAAGAAGACGCAAGTGGCTGG + Intergenic
1043115602 8:76250045-76250067 GAGAAGAAGGAGGAAGAGGAAGG - Intergenic
1043743340 8:83842302-83842324 TGCAAGAAGCAGCAAGTGTCAGG + Intergenic
1043796304 8:84546065-84546087 TGTGAGAAGGAGGAAGTGGCAGG + Intronic
1044714378 8:95087274-95087296 TATAAGAAGCAGTCAGTGGGTGG - Intronic
1045319685 8:101072631-101072653 AACAAGAGGCAGGAAGAGGCAGG + Intergenic
1046943759 8:119955869-119955891 TGGAAGAAGAAGGAAGGGGAGGG + Intronic
1047345132 8:124020424-124020446 AAGATGAAGCAGACAGTGGCAGG + Intronic
1047808681 8:128384277-128384299 TAGAAGAATCTGGAAGAGTCTGG + Intergenic
1048118609 8:131553802-131553824 ATGAAGAAGAAGGCAGTGGCTGG + Intergenic
1048179207 8:132179995-132180017 GAGGAGAAACAGGAAGTGGCGGG - Intronic
1049046507 8:140156179-140156201 TACACGAAGCAGGTGGTGGCGGG - Intronic
1049729754 8:144170251-144170273 TAGGACAAGCATGGAGTGGCTGG - Intronic
1049853798 8:144849197-144849219 CAGAGAATGCAGGAAGTGGCTGG + Intronic
1050636337 9:7616822-7616844 TAAAAGAAGGAGGAAGTGCTTGG + Intergenic
1051121404 9:13756237-13756259 CAGAAGAACCCTGAAGTGGCAGG - Intergenic
1051562891 9:18462640-18462662 TAGAAGAAGGAAAAAGGGGCCGG + Intergenic
1051848912 9:21486320-21486342 AAGAAGAAGCAGGAGGTGGTAGG - Intergenic
1053066548 9:35073085-35073107 GAGAAGGAGCAAGAAGTGTCAGG - Exonic
1053429128 9:38030395-38030417 TAGAGAAAGCAGCAAGTGGGAGG - Intronic
1054853522 9:69873363-69873385 TAGAAGTAGGAGGAAATGACCGG + Intronic
1054900992 9:70369545-70369567 TAGAAAATGTAGGAAGTGGCAGG + Intergenic
1055001570 9:71456211-71456233 TAGAAGAAGCAGTCTGTGTCAGG - Intergenic
1055298150 9:74854572-74854594 GAGAAGAAGGAGGAGGTTGCTGG - Intronic
1055306964 9:74939765-74939787 TACAAGAAGAAGAAAGCGGCCGG - Intergenic
1055383952 9:75740983-75741005 TAGAAGAAGCATAAAGCTGCCGG + Intergenic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055801102 9:80037221-80037243 TAGAAGAAGGAGGAACCTGCAGG + Intergenic
1057585319 9:96323628-96323650 TAGAAGAAGTAAGACGGGGCCGG + Intronic
1057754544 9:97821528-97821550 TAGAAAAAGCAGGCAAGGGCAGG + Intergenic
1058768576 9:108207837-108207859 TAGAAGCAGTAAGGAGTGGCAGG - Intergenic
1059361118 9:113742722-113742744 CAACAGAAGCAGGAAGAGGCTGG - Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1059700487 9:116771174-116771196 TAGAGGAAGCATGAAGTGCAAGG - Intronic
1060623598 9:125090475-125090497 AAGAAGGAGAAGGAAGGGGCAGG + Intronic
1060830263 9:126709346-126709368 CAGGAGAAGCAGGAAGGAGCAGG + Intergenic
1060896686 9:127223437-127223459 GAGAAGGAGCAGGATGAGGCTGG + Intergenic
1061615360 9:131775477-131775499 TAACAGAAGGAGGAAGTGGCAGG - Intergenic
1203756122 Un_GL000218v1:128586-128608 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1203649738 Un_KI270751v1:104834-104856 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1185499733 X:587655-587677 AAGAAAAAGCAAGAAATGGCAGG + Intergenic
1185814985 X:3146310-3146332 AAGAAGAAGAAGGAAGAGGGAGG - Intergenic
1185942898 X:4340982-4341004 CAGAAGAAGATGCAAGTGGCTGG - Intergenic
1186408148 X:9321797-9321819 AAGAAGAAGAAGGAAAGGGCAGG + Intergenic
1186458858 X:9732416-9732438 TGGGAAAAGCAGGAAATGGCGGG + Intronic
1186464037 X:9770566-9770588 GAGAGGAAGCAGGAAGTCACTGG + Intronic
1186645430 X:11501838-11501860 GAGAAGGAGCAGGAAGAGGAGGG + Intronic
1186775150 X:12857329-12857351 TAGAAGAAGAAAGGATTGGCCGG + Intergenic
1186827625 X:13356921-13356943 TAGAAGAAGTATTAAGAGGCAGG + Intergenic
1186957589 X:14700300-14700322 GAGAAAGAGCAGGAAGGGGCAGG + Intronic
1187705543 X:22006106-22006128 TAGGAGAACCAGGAAGGAGCTGG - Intergenic
1187830250 X:23374016-23374038 TAGAAGAAGTGGGAAGGGGGTGG + Intronic
1188453615 X:30336521-30336543 GAGAAGAAGCATGAAGTTGTGGG - Intergenic
1188520596 X:31033695-31033717 TGGAAGAAGAATGAAGAGGCAGG - Intergenic
1189451356 X:41134800-41134822 CAGATGAAGCAGTGAGTGGCTGG + Exonic
1189764345 X:44354699-44354721 CAAAAGAAGCAGAAACTGGCCGG + Intergenic
1189877748 X:45454449-45454471 TAGAAGAAGCAGGGAGGTACTGG + Intergenic
1190366783 X:49702372-49702394 TAGAAGATGCAGCCAATGGCGGG + Intergenic
1190827011 X:54026898-54026920 GTGTAGAAGTAGGAAGTGGCTGG - Intronic
1194221590 X:91200184-91200206 TGGAAGAAGACGCAAGTGGCTGG + Intergenic
1194739324 X:97553687-97553709 AAGAAGAAGAAGAAAATGGCTGG + Intronic
1195165210 X:102213235-102213257 GAGAAGAAGAAGGCAGTGACTGG - Intergenic
1195193648 X:102473856-102473878 GAGAAGAAGAAGGCAGTGACTGG + Intergenic
1195264468 X:103166390-103166412 TATAAGAAAGAGGCAGTGGCGGG - Intergenic
1195821539 X:108950324-108950346 TAGAGGAAGCAGGATATTGCCGG + Intergenic
1195907473 X:109859348-109859370 TAGAAGAAGGTGGAAGTAGGTGG + Intergenic
1195952642 X:110292174-110292196 GAAAAGAACCAGGAAGTTGCAGG + Intronic
1197711803 X:129676955-129676977 TAGCAGGAGCACGAAGGGGCAGG - Intergenic
1197947074 X:131851155-131851177 TAGCAGAAGCAGGAAGAGAGCGG - Intergenic
1198716104 X:139559256-139559278 TAGAAAAAGAGGGAAATGGCCGG + Intronic
1199243198 X:145572669-145572691 TAGAAAAAGCAGGCAGAAGCAGG - Intergenic
1199278666 X:145974564-145974586 TAGAGGAAGGTGGAGGTGGCGGG - Intergenic
1199732804 X:150653277-150653299 TACAAGAAGCTGGAAGAGGCGGG - Intronic
1200118686 X:153780566-153780588 TAGAAGAAGCAGGAAGTGGCTGG + Intronic
1200558103 Y:4663940-4663962 TGGAAGAAGACGCAAGTGGCTGG + Intergenic
1201546993 Y:15176264-15176286 GAGAGGAAGCAGTAGGTGGCTGG - Intergenic
1201571710 Y:15422290-15422312 GAGATTAAGCTGGAAGTGGCAGG + Intergenic