ID: 1200119204

View in Genome Browser
Species Human (GRCh38)
Location X:153782514-153782536
Sequence GAGCAGGCACAGAGGCCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 374}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200119204_1200119213 25 Left 1200119204 X:153782514-153782536 CCGAGAGGCCTCTGTGCCTGCTC 0: 1
1: 0
2: 4
3: 39
4: 374
Right 1200119213 X:153782562-153782584 ACAAAATGCACCATCCCAACTGG 0: 1
1: 0
2: 0
3: 11
4: 139
1200119204_1200119207 -4 Left 1200119204 X:153782514-153782536 CCGAGAGGCCTCTGTGCCTGCTC 0: 1
1: 0
2: 4
3: 39
4: 374
Right 1200119207 X:153782533-153782555 GCTCCTCCAGCGCCACCTCTAGG 0: 1
1: 0
2: 2
3: 25
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200119204 Original CRISPR GAGCAGGCACAGAGGCCTCT CGG (reversed) Intronic
900102712 1:968871-968893 GGGCAGCCACAGAGACCCCTCGG + Intronic
900284684 1:1893457-1893479 GAGCAGGCAGAGAGGCACCTGGG - Intergenic
900353731 1:2249664-2249686 GAGCCAGCACAGAGGGCTCACGG + Intronic
900539974 1:3197751-3197773 GAGCTGGCCCACAGGCCTCAGGG - Intronic
900917372 1:5648228-5648250 GAGCAGGCTCAGAGACCTCCAGG + Intergenic
901027055 1:6284244-6284266 GAGCAGGAACAGAGCCCTGGGGG - Intronic
901063584 1:6484951-6484973 AAGGAGAAACAGAGGCCTCTGGG + Intronic
902382023 1:16057232-16057254 GGGCAGGCACAGATGCCTTCTGG + Exonic
902713058 1:18253701-18253723 GAGGAGGCAATGAAGCCTCTGGG + Intronic
902874085 1:19330639-19330661 GGGCAGGTACAGAGGCCTGGAGG + Intergenic
902885977 1:19405105-19405127 GAGAAGGGACGGATGCCTCTTGG - Intronic
903217774 1:21852647-21852669 GAGGAGGCAGAGAGGCCTCCGGG - Intronic
903234419 1:21940317-21940339 GAGCAGGCACAAGGCCTTCTGGG + Intergenic
903674603 1:25055995-25056017 GAGCAGGCAGAGAGGGCTCCAGG + Intergenic
903690698 1:25171430-25171452 CGGCAAGCACAGAGGCCTCTGGG - Intergenic
903981626 1:27192855-27192877 GACCCAGCACAGAGACCTCTTGG + Intergenic
904295497 1:29517449-29517471 GAACAGGCAGAGAAGCTTCTGGG - Intergenic
904842395 1:33381174-33381196 AGGCAGGCACAGAGTGCTCTGGG - Intronic
909466168 1:75976582-75976604 GAGCAGCCACATAGGGCTGTGGG + Intergenic
910583004 1:88848781-88848803 CATGAGGCACAGAGGCCTCTTGG + Intergenic
914909355 1:151771625-151771647 GAGAAGGCACATAGATCTCTTGG + Intronic
914982869 1:152430718-152430740 CAGCAGCCACAGTGGGCTCTGGG + Intergenic
915243396 1:154539994-154540016 GAGTAGGCAGAGAGGTCACTGGG + Intronic
915519809 1:156435588-156435610 GAGCAGGCAGAGGCGCCTCGGGG - Intergenic
915585339 1:156841119-156841141 GAGCAGGGTCAGAGGCATCCGGG + Intronic
915917610 1:159950395-159950417 AAGCAGGCAGAGAGGCAGCTTGG - Intergenic
917399083 1:174626290-174626312 TAGGAGGCACTGAGGCCTATGGG - Intronic
919905628 1:202076480-202076502 GAACAAGCACAGAGGCCTGCAGG - Intergenic
920249651 1:204615105-204615127 GAGCAGGCAAATGGTCCTCTGGG + Intergenic
920350925 1:205337493-205337515 GAGCAGGCACAGCGGGGTGTGGG + Exonic
921064947 1:211616221-211616243 GTGCAGGCTCAGAGGACTGTGGG - Intergenic
921148363 1:212380073-212380095 GAGAGTACACAGAGGCCTCTGGG + Intronic
921339358 1:214119105-214119127 GAGCAGAATCAGAGGCCTCCTGG + Intergenic
922458233 1:225794336-225794358 CAGCAGGAAGAGAGGACTCTGGG - Intergenic
922950228 1:229552982-229553004 GAGCAGGGGCAGAGACCTCATGG + Intronic
923865792 1:237938164-237938186 GAGCAGGCACGGAGGCCCTGGGG + Intergenic
1063008067 10:1993890-1993912 TAGGAGGGACAGATGCCTCTGGG - Intergenic
1065638846 10:27759909-27759931 GAGCAGCCACAGATGCCACCGGG + Intergenic
1066499063 10:35972446-35972468 GAGCAGGCACAGAAGCCAAGAGG - Intergenic
1068572641 10:58647662-58647684 GAGCAGCCAAAGAGGGTTCTGGG - Intronic
1069739047 10:70675797-70675819 GAGCTGGCACAGCAGCCTCAAGG + Intronic
1069808040 10:71138151-71138173 AAGGAGGCACAGTGGGCTCTGGG + Intergenic
1069941734 10:71961377-71961399 CAGCAGGAAGAGAGGACTCTGGG + Intergenic
1070552115 10:77498119-77498141 GAGAAGGCAGGGAGGCCCCTTGG + Intronic
1070593728 10:77818245-77818267 GACAAGGCACAGAGGACTTTGGG + Intronic
1071306322 10:84302340-84302362 GAGCAGGCACCTTGGCCTCATGG + Intergenic
1071365065 10:84891125-84891147 GAGCAGCCACAGATGGCTCTGGG - Intergenic
1071672430 10:87621128-87621150 GTGAAGGCACAGAGTTCTCTTGG + Intergenic
1074327721 10:112469075-112469097 CAGCAGGCAATGAGGACTCTGGG - Intronic
1074897996 10:117793590-117793612 GAGCAAGCAGGGAGGCATCTGGG + Intergenic
1075062340 10:119265855-119265877 GAGCAGCCATAGAGGTCTCCTGG - Intronic
1075091580 10:119446817-119446839 GAGCAGCCAGACTGGCCTCTTGG - Intronic
1075441958 10:122487006-122487028 GGGCAGGCACACAGGCCTGTTGG + Intronic
1076503032 10:130951853-130951875 TAGCAGGCAGAGCCGCCTCTGGG - Intergenic
1077135296 11:995045-995067 CAGCAGGCACAGTGGCCCCCGGG - Intronic
1077333407 11:1993194-1993216 GGGAAGGGACACAGGCCTCTTGG - Intergenic
1077493127 11:2871253-2871275 GAGCATGCTCAGAGCCCTCCAGG - Intergenic
1077496099 11:2887081-2887103 GAGCCAGCAGAGAGACCTCTGGG + Intergenic
1078507801 11:11965452-11965474 GAGCTGGCAGAGAGGCCACGGGG - Intronic
1078650348 11:13185272-13185294 GAACAGGCACTGAGGACTCATGG + Intergenic
1079133030 11:17760600-17760622 CAGCAGGTACAGAGGGCCCTAGG - Intronic
1081772243 11:45657143-45657165 GAGCTGGCGAACAGGCCTCTAGG + Intronic
1081965331 11:47165767-47165789 TGGCAGACACAGAGGCATCTTGG + Intronic
1083640282 11:64141712-64141734 GTGCAGGCGCTGAGGCCTCAAGG + Intronic
1083700606 11:64475347-64475369 GAGCGGGCACAGCGACATCTCGG + Intergenic
1084001989 11:66300904-66300926 GAGCAGAGGCAGAGGCCGCTGGG - Intergenic
1084274239 11:68043543-68043565 GAGCAGGCTCAGCTGACTCTGGG - Intronic
1084483800 11:69436679-69436701 GTTCAGGCACAGAGGCCGCATGG + Intergenic
1084904600 11:72335939-72335961 AACCAGGCAGAGAGGCTTCTGGG - Intronic
1085000077 11:73025467-73025489 CAACAGGCACTGAGGCCTTTTGG + Intronic
1085119444 11:73957771-73957793 GAGCAGACACACAGGCATCTTGG - Intronic
1085446429 11:76604042-76604064 GACCAGGGACAAAGGCCCCTTGG + Intergenic
1085522369 11:77146178-77146200 GCGAAGTCACAGAGGCCTTTGGG + Intronic
1085544966 11:77309913-77309935 TAGCAGGCACAGAGAAATCTGGG + Intergenic
1089528747 11:119113248-119113270 GAAATGCCACAGAGGCCTCTGGG - Intronic
1089748185 11:120631598-120631620 GAGAGGGGACAGAGGCCTTTGGG + Intronic
1090354923 11:126133957-126133979 GATCAAGGACAGAGGCCTTTGGG - Intergenic
1091207878 11:133833431-133833453 GAGAAGCCGCAGAAGCCTCTGGG + Intergenic
1091236871 11:134028022-134028044 CACCAGGCACAGAGAGCTCTGGG - Intergenic
1202816385 11_KI270721v1_random:48375-48397 GGGAAGGGACACAGGCCTCTTGG - Intergenic
1091545890 12:1501048-1501070 CAGCCCTCACAGAGGCCTCTGGG + Intergenic
1092986195 12:13848425-13848447 AAGCAGGAAAAGAGTCCTCTGGG + Intronic
1093281779 12:17204120-17204142 GAGAAGGCAGAGAGGCTCCTGGG + Intergenic
1095947587 12:47762364-47762386 GAGCAGGAGGAGAGGCCTCCTGG - Intronic
1097650556 12:62292605-62292627 GCTCAAGCACAGAGGCCACTTGG + Intronic
1100009407 12:89935681-89935703 GAGTAGGGACTGTGGCCTCTGGG + Intergenic
1100355104 12:93821383-93821405 GAGCTGGCACATCGGTCTCTAGG + Intronic
1101150431 12:101877952-101877974 GAGCAGGCACAGGGACCACAGGG + Intronic
1103636339 12:122309681-122309703 CAGCACGCTCAGAGGCCACTCGG - Intronic
1103852463 12:123942121-123942143 CAGCAGGCACAGAGGGCCCTGGG + Intronic
1104785525 12:131445878-131445900 GCCCTGACACAGAGGCCTCTGGG + Intergenic
1105291338 13:19055630-19055652 AAGCAGGCACACTGGCTTCTTGG - Intergenic
1105545594 13:21348367-21348389 GCTCAGACACAGAGTCCTCTGGG - Intergenic
1105800972 13:23903315-23903337 GAGCAGGAGCAGAGGCCACGCGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107792128 13:44013276-44013298 GACCAGGCTCAGAGCCCTGTGGG - Intergenic
1108707272 13:53000959-53000981 GAGCAGGCACAGAGGCATCCAGG + Intergenic
1112551334 13:100423803-100423825 GAGCAGTGAGAGAGGCCTTTGGG + Intronic
1112781338 13:102904225-102904247 GAGCAAGCAGAGAGGACACTGGG + Intergenic
1113764747 13:112874297-112874319 GAGCAGGCATGGTGGCCTCCTGG + Intronic
1113797069 13:113064704-113064726 GCGCAGGCACAGGCGACTCTAGG + Intronic
1114473074 14:22977131-22977153 GCTCAGGCAAAGAGGCTTCTAGG - Intronic
1114669591 14:24401988-24402010 CAACAGGCAGAGAGGACTCTGGG + Intronic
1116110572 14:40575541-40575563 GAGCAGTCAAAGAGGCTTTTAGG - Intergenic
1117872696 14:60217702-60217724 GTGCTGGCACAGAGGCCCATGGG - Intergenic
1118993108 14:70813474-70813496 AAAAAGGAACAGAGGCCTCTGGG + Intergenic
1119485047 14:74981532-74981554 GAGCAGGCGCAGAGGCAGCCAGG - Intergenic
1119524471 14:75311108-75311130 GAACAGGCAAAGAGGCCTCTGGG + Intergenic
1120791063 14:88582572-88582594 GAGCACACAGAGAGGCTTCTGGG + Intronic
1121296881 14:92834543-92834565 GAGCAGGCACAAAGGCCTTGAGG + Intronic
1121647137 14:95526152-95526174 GCAAAGGCACAGAGGCCCCTGGG - Intergenic
1121693139 14:95892191-95892213 GACCAGGCACAGAACCTTCTGGG - Intergenic
1122082909 14:99279040-99279062 GAGCTGGCACAGAGGTGTCATGG + Intergenic
1122606561 14:102950508-102950530 GTCCACGCCCAGAGGCCTCTTGG + Exonic
1122606563 14:102950515-102950537 GAGCAGTCCAAGAGGCCTCTGGG - Exonic
1122643253 14:103174847-103174869 CAGCAGGAAGAGAGGACTCTGGG + Intergenic
1123000449 14:105291191-105291213 GAGCAGGGCCAGAGGCCGCAGGG + Intronic
1126667347 15:51087289-51087311 GAGCTGCCACAGAGGCCTGCTGG + Intronic
1127054292 15:55115927-55115949 GTGCATGCACAGTGGCCTCTTGG + Intergenic
1127503970 15:59580540-59580562 GAGCAGACAAAGAGGACTCTAGG - Intergenic
1128538189 15:68506233-68506255 GATCAGGCCCTGAGACCTCTAGG - Intergenic
1128552222 15:68605688-68605710 GAGGAGTCACAGAGGGCTCTTGG + Intronic
1129390156 15:75216262-75216284 TCGCAGGCAGAGAGGCCACTTGG + Intergenic
1129461711 15:75703081-75703103 GAGAAGGCAGAGAGGGCCCTGGG + Intronic
1129606412 15:77027317-77027339 ATGCAGGCACAGTGGCCACTGGG - Intronic
1129675257 15:77629904-77629926 AAGCAGGCAGAGAGGCTTCTTGG + Intronic
1129723141 15:77888765-77888787 GAGAAGGCAGAGAGGGCCCTGGG - Intergenic
1130044943 15:80436233-80436255 GAGCAGTCACCAAGGCTTCTGGG + Intronic
1130094241 15:80844270-80844292 GCGCAGGCAGAGAGGCCCCGAGG - Intronic
1130257570 15:82332873-82332895 GAACAGGAACTGAGGCCCCTGGG + Intergenic
1130273124 15:82462734-82462756 GAACACACACAGAAGCCTCTGGG + Intergenic
1130487216 15:84404715-84404737 GAACACACACAGAAGCCTCTGGG - Intergenic
1130587765 15:85194700-85194722 GAACACACACAGAAGCCTCTGGG + Intergenic
1130597372 15:85257091-85257113 GAACAGGAACTGAGGCCCCTGGG - Intergenic
1130955741 15:88626218-88626240 GAGCAGACTCAGGGGCCTCCCGG - Exonic
1131683266 15:94745830-94745852 GAGCAGGAAGAGAGGCCAGTGGG - Intergenic
1132097461 15:98998251-98998273 GAGCAGGAACAGAGTCTTATGGG - Intronic
1132510473 16:338466-338488 GCCCAGGCAAAGGGGCCTCTCGG + Intronic
1132735869 16:1385592-1385614 GGACAGGCACAGACACCTCTGGG + Intronic
1132907449 16:2290153-2290175 GAGCAGGTACTTAGGCCTCACGG - Intronic
1133049885 16:3111669-3111691 GAGCTGGTACAGAGGCAGCTGGG + Intergenic
1133092377 16:3414216-3414238 GGGCAGCCACGGAGCCCTCTGGG + Intronic
1135390074 16:22085105-22085127 GAGCAAATACAGAGGCCTTTAGG + Intronic
1136394883 16:29987368-29987390 GAGCTGGCGCCGAGGCCTCATGG + Exonic
1136412840 16:30086785-30086807 CAGCAGCCACAGAGGCCTATGGG - Exonic
1136499916 16:30664943-30664965 GATGAGGCTCGGAGGCCTCTGGG + Intronic
1136999442 16:35216388-35216410 GGGCAGGGACAGAGGCCAATGGG - Intergenic
1138346124 16:56321298-56321320 CTGCAGCCACAGAGACCTCTGGG - Intronic
1138419969 16:56892718-56892740 GGGCAGTCCCAGAGCCCTCTGGG - Intronic
1139474996 16:67198662-67198684 AAGAAGGAACAGAGGTCTCTGGG + Exonic
1140870976 16:79106193-79106215 TAGCAGGCACTGAAGTCTCTTGG - Intronic
1140920560 16:79533743-79533765 GAGGTGGCACAGAGGTCACTGGG - Intergenic
1141165146 16:81655328-81655350 GAGCAGGCAGAGGGGCATCGTGG + Intronic
1142183857 16:88685381-88685403 GAGCTGGGATAAAGGCCTCTTGG + Intronic
1142246412 16:88972171-88972193 CAGCAGCCACTGAGGCCTCAGGG + Intronic
1142262535 16:89049655-89049677 GAGGCGGCAGGGAGGCCTCTGGG + Intergenic
1142985896 17:3695299-3695321 GTGCAGAGATAGAGGCCTCTGGG + Intronic
1145046612 17:19622647-19622669 GAGCTGGCATAGAGGCCCTTTGG - Intergenic
1146559709 17:33857534-33857556 GTCTAGGCTCAGAGGCCTCTGGG + Intronic
1147336112 17:39727732-39727754 CAGCAGGCAGAGGGCCCTCTCGG - Exonic
1147484071 17:40795833-40795855 CAGCAGGAACAGAGTCCTCAGGG + Intronic
1147606554 17:41777044-41777066 GGGCTGGCACAGAGACCTGTCGG + Intronic
1148079036 17:44957435-44957457 GATCAGTCCCAGTGGCCTCTGGG + Intergenic
1148123454 17:45225198-45225220 GGCCAGGCACCCAGGCCTCTGGG - Intronic
1148322451 17:46765741-46765763 GGGCAGCCACAGAGGCTCCTGGG - Intronic
1148445365 17:47733965-47733987 GCGCGGGCACAGAGGCCCCAAGG - Intronic
1149576909 17:57720527-57720549 GAGCAGGGCCAGATGCTTCTTGG - Intergenic
1151232551 17:72695160-72695182 AGGGAGGGACAGAGGCCTCTGGG - Intronic
1151367586 17:73627479-73627501 AAACAGGCACAGAGGCCACAGGG + Intronic
1151969189 17:77449178-77449200 GAGCAGCCCCAGAGCCTTCTCGG - Intronic
1152065300 17:78109235-78109257 CAGCAGACACAGAGGCATCATGG + Intergenic
1152067982 17:78121913-78121935 GCCCAGGCACAGGGGCCTCTCGG - Intronic
1152239062 17:79152185-79152207 CTGCAGGGACAGAGCCCTCTGGG - Intronic
1152423949 17:80208989-80209011 GAACAGGCACAGGGGCCACGGGG - Exonic
1154196982 18:12273881-12273903 GATCAGGGACAGACGCCTCGTGG + Intronic
1155798794 18:30074051-30074073 ATGCAGGGACAGAGGCCTCATGG + Intergenic
1156405831 18:36781749-36781771 ACACAGGCACAGAGGCCTATGGG - Intronic
1157193605 18:45601430-45601452 GAGCATGCACACTGTCCTCTTGG - Intronic
1157291230 18:46411337-46411359 GGCCAAGTACAGAGGCCTCTAGG - Intronic
1157443925 18:47730845-47730867 GACCAGGCACTGAGACCTTTAGG - Intergenic
1158092181 18:53727392-53727414 CTGCAGGGACAGAGGCCTCGTGG - Intergenic
1158668880 18:59456818-59456840 GAGCAGGCCCAGAGGCAGCCTGG + Intronic
1158945161 18:62441714-62441736 GAGAAGACACTGAGGCCTCTAGG + Intergenic
1159369909 18:67516706-67516728 GAGCTGGCACAGAGGATCCTCGG - Exonic
1159758166 18:72391333-72391355 TTGCAGGCACAGATGCTTCTTGG + Intergenic
1160078989 18:75704709-75704731 GAGACAGCACAGAGGCGTCTAGG - Intergenic
1160758124 19:768676-768698 CAGCAATCACAGAGGCCTTTGGG + Intergenic
1161861540 19:6801761-6801783 GTGCAGGGACAGAGGCCTCTGGG - Intronic
1162854908 19:13460729-13460751 CAGCAGGTACAAAGGCCCCTGGG - Intronic
1166007449 19:39917192-39917214 GGGCAGACATAGAGGCCACTAGG - Intronic
1166175541 19:41066463-41066485 CAGCAACTACAGAGGCCTCTAGG - Intergenic
1167588172 19:50386811-50386833 CAGCAGTCACAGAGGCCTAGGGG + Intronic
1167623134 19:50569598-50569620 GGGCAGATGCAGAGGCCTCTGGG + Intergenic
1167708139 19:51093926-51093948 TGGCAGGCACAGAGGCCTGCAGG - Intergenic
1167712662 19:51122015-51122037 GAGGAGTCACAGGGGACTCTGGG - Intergenic
1167824683 19:51961452-51961474 GAGCATGCACAGAGGCCTGAAGG + Intergenic
1167949636 19:53015848-53015870 GAGCAGGCAAGGAAGCCCCTGGG + Exonic
1168450880 19:56465789-56465811 GACCCTGCACACAGGCCTCTTGG - Intronic
1168469911 19:56631292-56631314 GAGAGAGCACAGAGGCCTCTTGG - Intergenic
926131099 2:10303551-10303573 CAGCAGGGACAGGGGGCTCTGGG - Intronic
926218371 2:10919424-10919446 CCGCAGGCACAGGGCCCTCTTGG - Intergenic
926220519 2:10932901-10932923 CAGCAGGGGCAGAGCCCTCTGGG + Intergenic
926293337 2:11548643-11548665 GAGCAGGGACAGAAGGCTCCAGG - Intronic
926344178 2:11930561-11930583 GAACAAATACAGAGGCCTCTGGG + Intergenic
926959011 2:18332963-18332985 GAGGAGGCACACAGCCCCCTGGG - Intronic
927127255 2:20023065-20023087 CACCAAGCCCAGAGGCCTCTTGG + Intergenic
927972740 2:27316011-27316033 GAGCAGCCACAGGGGCCTCCTGG - Intronic
928402749 2:30991172-30991194 GAGCAGTCACAGGTGTCTCTCGG + Intronic
928538042 2:32258813-32258835 GAGCAGTCTCAGAGGCTTCTGGG - Intronic
928539840 2:32274444-32274466 GAGCAAGCACAGAAGCCTTGAGG + Intergenic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
932752773 2:74382042-74382064 TAGAAAGCACAGAGGGCTCTGGG - Intronic
932839397 2:75067732-75067754 AAGCAGGCACAGAGGCCCTAAGG + Intronic
933937088 2:87215295-87215317 GAGGGGGCACAGAGGTATCTGGG - Intergenic
934751190 2:96795240-96795262 CAGCAGGCACAGAGGCCTGGGGG + Intronic
935085784 2:99843362-99843384 GAGGAGGCTCAGAGGCAGCTGGG - Intronic
935318148 2:101858196-101858218 GAACAGGGACTGAGGCCTCCTGG + Intronic
935699517 2:105799509-105799531 AAACAGACCCAGAGGCCTCTGGG - Intronic
936356053 2:111750529-111750551 GAGGGGGCACAGAGGTATCTGGG + Intergenic
936717792 2:115209645-115209667 GAGCAGGCAAACAAACCTCTGGG + Intronic
936840814 2:116765947-116765969 GACCAGGAAAAGAGGCCCCTGGG - Intergenic
936957790 2:118040791-118040813 CAGCAGGAACAGAGCCTTCTGGG - Intergenic
938299717 2:130201370-130201392 AACCAGGAAGAGAGGCCTCTGGG - Intergenic
938420390 2:131141114-131141136 GAGAAGTCAAGGAGGCCTCTGGG + Intronic
938456991 2:131473116-131473138 AACCAGGAAGAGAGGCCTCTGGG + Intronic
938462804 2:131509015-131509037 GAGCAGGCAAAGAAGGCTCCAGG - Intergenic
938780966 2:134584455-134584477 GAGCAGGCATATAGGCCACCTGG - Intronic
940988666 2:160075522-160075544 TAGCAGGCAGAGAGGGCTCTGGG + Intergenic
941583813 2:167331932-167331954 GCGCATGCTCAGAGGCCTCAAGG - Intergenic
942173805 2:173311951-173311973 TAGCACGCACAAAGGCCTCAAGG + Intergenic
945138096 2:206651789-206651811 GTCCAGGCTCAAAGGCCTCTTGG - Exonic
946009036 2:216550069-216550091 GAGGAATCACAGATGCCTCTTGG - Intronic
948339024 2:237234133-237234155 GAGTAACAACAGAGGCCTCTGGG - Intergenic
948467144 2:238158113-238158135 AAGGTGGCAGAGAGGCCTCTGGG - Intergenic
948667237 2:239544301-239544323 CAGCATGCGCAGAGGACTCTGGG + Intergenic
948806998 2:240457311-240457333 CAGCAGGCACAGAGGCTACAGGG + Intronic
948860400 2:240750100-240750122 GAGCAGGCTCAGATGGCACTGGG + Intronic
949032340 2:241803009-241803031 GAGGAGACCCAGAGGCCTCTAGG - Intronic
1170770969 20:19332260-19332282 GAGCAGGAACAGAAGCCAGTGGG + Intronic
1171067594 20:22033407-22033429 GAGCAGGAAGAGAGGGGTCTCGG - Intergenic
1171179737 20:23084006-23084028 GTGCAGGCACAGAGGCGCCATGG - Intronic
1172973174 20:38888237-38888259 GAGGAGGCTCAGAGGGCTCAGGG + Intronic
1173067644 20:39728649-39728671 ACACAGGCAGAGAGGCCTCTTGG + Intergenic
1173158334 20:40633674-40633696 GAGCAGGTTCAGGGGGCTCTTGG - Intergenic
1173165097 20:40682568-40682590 GTGCCCGCCCAGAGGCCTCTTGG - Intergenic
1173388149 20:42607778-42607800 GAGCAGGCAGAGGGACCTGTGGG + Intronic
1173897061 20:46559173-46559195 TTGCAGCCACAGAGGCCTATGGG + Exonic
1174401009 20:50275959-50275981 GAGTTGTCCCAGAGGCCTCTAGG + Intergenic
1175082998 20:56437016-56437038 GAGCAGGGACAAGAGCCTCTGGG + Intronic
1176089318 20:63311991-63312013 GACCAGGCGCACAGGCCTCGGGG - Exonic
1176217654 20:63955940-63955962 GAGCAGGCACACAGCCCGCCGGG + Intronic
1177360659 21:20064798-20064820 GAGTAGGCACAGAAGCTTCGAGG + Intergenic
1177916038 21:27089091-27089113 GTGCAGGAATTGAGGCCTCTTGG + Intergenic
1180230714 21:46425377-46425399 GACCACGCACAGAGGCCTCCTGG + Intronic
1180842738 22:18966860-18966882 GGCCTGGCACAGAGTCCTCTCGG + Intergenic
1181631070 22:24151681-24151703 CAGCAGGCTCCAAGGCCTCTTGG - Intronic
1181744359 22:24945514-24945536 GAACAGGCAAGGATGCCTCTAGG + Intronic
1183336237 22:37248496-37248518 AAGCATGCCCAGAGGCCTCGTGG - Intergenic
1183417688 22:37691885-37691907 GGACAGGCACAGAGGCTCCTCGG - Exonic
1183979811 22:41532824-41532846 GAGCAGCCACACAGGCCCCCAGG - Intronic
1184529893 22:45048744-45048766 GAGCAGGGAGAGAGGCCACGAGG - Intergenic
1184777307 22:46629602-46629624 GCTCAGGCACAGAGGCCTTGGGG + Intronic
1184894981 22:47401460-47401482 GAGCAGGCATTGAGGGCTCAGGG + Intergenic
1184993754 22:48187625-48187647 GAGCAGGCAGAATGGCCTCCTGG - Intergenic
1185109729 22:48894246-48894268 GCCCAGGCAGAGGGGCCTCTGGG - Intergenic
1185234459 22:49704150-49704172 GGGCAGGCAGAGTGGCCTCCAGG + Intergenic
1185274977 22:49946829-49946851 GTGCTGGCACTGAGGTCTCTGGG + Intergenic
949394693 3:3602462-3602484 GAGCAAGCCCAGAGCCCTCCTGG + Intergenic
950155573 3:10719117-10719139 GGTCAGCCAGAGAGGCCTCTGGG + Intergenic
950172148 3:10846371-10846393 GAGTTGACACAGAGGCCTGTGGG + Intronic
950565322 3:13766541-13766563 TAGAAGGCACTGAGGCCACTCGG - Intergenic
952945329 3:38475077-38475099 GAGGAGGCCCTGTGGCCTCTGGG + Intronic
953180438 3:40589756-40589778 CAGCATGCTCAGAGGGCTCTTGG - Intergenic
953414530 3:42708126-42708148 GAGCAAACAAAGATGCCTCTTGG + Intronic
954782692 3:53072902-53072924 GAGCAGGCAGAGAGGGCGGTGGG - Intronic
955548410 3:60056928-60056950 GACCAGGAAGAGTGGCCTCTGGG - Intronic
957225627 3:77441624-77441646 CAGCTGGGACAGAGGCCTTTGGG + Intronic
957379326 3:79405430-79405452 GAGCAGCCACAGAGGTGACTGGG - Intronic
958836875 3:99156714-99156736 TAGCAGGGACAGAGCCCTCATGG + Intergenic
959626455 3:108457534-108457556 GGGCAGGGACAGTGGCTTCTTGG - Intronic
960088237 3:113613290-113613312 GAGCAGGCTCGGAGCCTTCTGGG + Intronic
960994823 3:123333715-123333737 GAGCAGGCCCAGTGCCCTCGAGG - Intronic
962007704 3:131363915-131363937 GAGCAGGCATGGAGGACTGTGGG - Intergenic
962301027 3:134243222-134243244 GAGGAGTCACAGAGGAATCTAGG - Intronic
965216941 3:165875205-165875227 GAGCAGGGAGAGAAGCCTCCTGG - Intergenic
966311733 3:178601673-178601695 GAGAAGCCACCAAGGCCTCTAGG - Intronic
967852888 3:194095517-194095539 GAGCAGGAACAGAGGTGCCTGGG - Intergenic
967943633 3:194785385-194785407 AAGCAGGCACTGAGTGCTCTTGG - Intergenic
968516632 4:1018267-1018289 GTGTAGGCAGAGCGGCCTCTGGG + Intronic
968802327 4:2751417-2751439 TAAGAGGCACAGTGGCCTCTTGG + Intronic
968864443 4:3198858-3198880 GGCCGGGCACAGAGGCCACTTGG + Intronic
968978255 4:3833118-3833140 CAGCCGGGCCAGAGGCCTCTTGG + Intergenic
969045184 4:4331478-4331500 GGCCAGGCACACAGGGCTCTGGG - Intergenic
969337361 4:6519498-6519520 CTGCAGCCACACAGGCCTCTGGG + Intronic
969695035 4:8729523-8729545 CAGGTGGCACAGAGGCCTATGGG + Intergenic
970410276 4:15799727-15799749 GAGCAGGAGCACAGTCCTCTTGG + Intronic
971134117 4:23848411-23848433 GCTCAGGCAAAGAGGACTCTGGG - Intronic
971169056 4:24214601-24214623 GAGCAAGTGCAGAGGACTCTGGG - Intergenic
972671473 4:41216454-41216476 GCGCAGGCGCAGAGGCCGCCAGG + Intronic
972872079 4:43312878-43312900 GGGCTGCCACAGAGGTCTCTGGG - Intergenic
976134608 4:81922197-81922219 CAGCAGGCAGAAAGGCATCTGGG - Intronic
978350786 4:107818762-107818784 GATCTGGAACAGATGCCTCTAGG + Intergenic
983124717 4:163936603-163936625 GACCTGGGACTGAGGCCTCTGGG + Intronic
985513624 5:325652-325674 GAGCAGGGACAGATGCCGGTGGG - Intronic
985628137 5:1000695-1000717 CAGCAGGCACAGAAGCCTGAGGG - Intergenic
985764459 5:1769452-1769474 GGGCAGGAGCAGAGGCCTCCCGG + Intergenic
987935614 5:24460657-24460679 GAGAAGGCAAAGATCCCTCTTGG - Intergenic
990003869 5:50923241-50923263 GTGCAGACGCAGAGGCCTCTTGG - Intergenic
990288554 5:54325931-54325953 GAGGAGGCAAAGATGTCTCTAGG + Intergenic
991507696 5:67342550-67342572 CAGCAGTGACAGAGGCCTCCAGG - Intergenic
991548995 5:67816149-67816171 GAGAAGGCACAAAGGCCTGTGGG + Intergenic
994665232 5:102697013-102697035 GAGCAGGCACACAGGGTTCAGGG - Intergenic
995291716 5:110463932-110463954 TAGGAGGCACAAAGGCCTCCAGG - Intronic
995518482 5:112977044-112977066 AAGAAGACCCAGAGGCCTCTGGG - Intronic
997458806 5:134038321-134038343 CAGCAGGTTCAGAGGCCCCTGGG + Intergenic
998142587 5:139708604-139708626 CAGCAGGCACAGAGGCTCCAAGG - Intergenic
998169815 5:139865951-139865973 AAGCAAGCACTGTGGCCTCTTGG + Intronic
999859986 5:155634373-155634395 GAGCAGCCACAGAGGTTTCCGGG + Intergenic
1000653264 5:163844564-163844586 CAACAGACACAGAGGCCTGTTGG + Intergenic
1001236029 5:170030355-170030377 GAGCAGGCACAGGGGCCCCATGG - Intronic
1001542680 5:172550440-172550462 GAGCTGGCACAGTGGGGTCTTGG + Intergenic
1002469171 5:179424719-179424741 AAGAAGGCATAGAGGTCTCTCGG + Intergenic
1002583499 5:180225631-180225653 AAGGACGCAGAGAGGCCTCTAGG + Intergenic
1002826064 6:775515-775537 GAGCAGGCAGAGGGGCATCCTGG - Intergenic
1002929428 6:1623359-1623381 GCACAGGCTCAGAGACCTCTAGG + Intergenic
1003406034 6:5828128-5828150 GCTCAGACACAGAGTCCTCTGGG + Intergenic
1004011215 6:11689745-11689767 CAGCAGACACTGAGGCCTATTGG + Intergenic
1006155860 6:32012416-32012438 CAGGAGGCTCAGGGGCCTCTGGG + Intergenic
1006162193 6:32045270-32045292 CAGGAGGCTCAGGGGCCTCTGGG + Exonic
1006164898 6:32058329-32058351 AACCAGGCACAGAGGCCCCAGGG - Intronic
1007343644 6:41209873-41209895 CAGGAGCCACAGAGGTCTCTGGG + Intergenic
1007346653 6:41236321-41236343 CAGGAGCCACAGAGGTCTCTGGG - Intronic
1007599123 6:43070931-43070953 GGGCAGGCGGAGAGGCCACTTGG + Intronic
1009958640 6:70489970-70489992 GAGCAGGCAAGGGAGCCTCTGGG - Intronic
1010771218 6:79833350-79833372 GAGCAGAGACGGAGGCCACTGGG - Intergenic
1011881615 6:92034753-92034775 GAGCAGGCCCAAATCCCTCTGGG + Intergenic
1012350275 6:98241757-98241779 GAGCATGTACAGAGGCCTGGAGG + Intergenic
1012793675 6:103734021-103734043 GAACAGGCAGAGAAGCCTCCTGG + Intergenic
1014189847 6:118482741-118482763 GAGCAGGAACAGAGGGCAATGGG - Intronic
1015786364 6:136923546-136923568 GAGCTGGCACCGAGGTCACTTGG - Intronic
1016937390 6:149457245-149457267 CAGCAGGCACAGGGGCCTCCTGG + Intronic
1017962033 6:159231976-159231998 AAGCAGGCACAGAGGGGTGTTGG - Exonic
1018432668 6:163735248-163735270 GAGTAGGCACAGGGACCTCGGGG - Intergenic
1018736396 6:166689938-166689960 CAGCAGGACCAGAGGCCTCCTGG - Intronic
1019172698 6:170142963-170142985 GACGAGGCACCGAGGCCCCTGGG + Intergenic
1019260741 7:80575-80597 GAGCAGCCAGGGAGGCCTCCCGG - Intergenic
1021843675 7:24743721-24743743 GGGAAGGCACAGGGGCATCTGGG - Intronic
1023834266 7:44059214-44059236 GTGCAGGAACAGAGGCCCCAGGG - Intronic
1024360128 7:48459537-48459559 GAGCAAGCACAGAGGATCCTTGG - Intronic
1027141143 7:75658536-75658558 AAGGAGGCACAGAGGTCGCTGGG + Intronic
1028066353 7:86390094-86390116 AAGCAGTTTCAGAGGCCTCTGGG - Intergenic
1029625616 7:101718630-101718652 GCTCAGCTACAGAGGCCTCTTGG + Intergenic
1030442062 7:109598168-109598190 GAGTAGGCAAAGAGGAATCTGGG - Intergenic
1031986979 7:128169523-128169545 GAGCATCCTCAGAGGTCTCTGGG - Intergenic
1032786621 7:135205827-135205849 CAGCAGGCACAGAGGACTGCAGG + Intronic
1033460605 7:141544061-141544083 AAGCAAACACAAAGGCCTCTGGG - Intergenic
1033652156 7:143351776-143351798 GAGATGGCACAGGGGTCTCTGGG - Exonic
1034156486 7:148959835-148959857 CAGCATGGACAGAGGCCTCTGGG + Intergenic
1034293170 7:149948366-149948388 GAGCAGGCACAGAGGTCACAAGG - Intergenic
1034351158 7:150415704-150415726 CATCAGGGACAGGGGCCTCTGGG + Intergenic
1034812903 7:154148513-154148535 GAGCAGGCACAGAGGTCACAAGG + Intronic
1034876769 7:154731423-154731445 GGGCAGCCATAGAGGCTTCTGGG + Intronic
1035085142 7:156251981-156252003 GAGGAGGCACCGAGCCCTCCAGG + Intergenic
1037805554 8:22056379-22056401 CAGCAGCAACTGAGGCCTCTGGG - Intronic
1037807772 8:22067847-22067869 GAGCAGGCAGAACGGTCTCTGGG + Intronic
1038072553 8:24033407-24033429 GAAAAAGCACAGAAGCCTCTGGG - Intergenic
1039840837 8:41291858-41291880 GAGCACGGACAGAGGCACCTTGG + Intronic
1040098083 8:43467656-43467678 GAGGAAGAACAGAGGTCTCTAGG + Intergenic
1040896792 8:52376345-52376367 GAGCCAGCACAGAGGCCTCGTGG - Intronic
1042526670 8:69771682-69771704 CAGCAGTGACAGAGACCTCTGGG - Intronic
1042648560 8:71013985-71014007 GAGTAGGCACAGGGGCATCGGGG - Intergenic
1045327063 8:101125293-101125315 GTGCAGGCACAGATGTCTCTGGG - Intergenic
1045360065 8:101424835-101424857 GAGGAGGAACAAAGGCCTGTTGG - Intergenic
1047754028 8:127904900-127904922 GTGCAGGCACACAGGGCTCCTGG - Intergenic
1048878762 8:138856891-138856913 GAGCAGCCAGAGAGGTCACTGGG - Intronic
1049350347 8:142160943-142160965 GAGGAGTCACAGAGGCCACAGGG - Intergenic
1049396487 8:142403321-142403343 GCGCACCCGCAGAGGCCTCTTGG - Intergenic
1049555402 8:143278989-143279011 GAGAAGGCACTGAGGACACTGGG - Intergenic
1050146591 9:2574594-2574616 GAGCAGGCACAGATGACCCAAGG + Intergenic
1050271431 9:3950030-3950052 GAGCAGGCAGTGAAGGCTCTGGG - Intronic
1053806057 9:41803091-41803113 GACAAAGCACAGAGGCTTCTGGG - Intergenic
1055785038 9:79863091-79863113 GGGCAGGCGCAGAGGCCTTTAGG - Intergenic
1056509347 9:87288376-87288398 GATCAGGCACACATGCCTTTAGG - Intergenic
1056753706 9:89369208-89369230 TAGCAGCCACAGTGGCCTGTTGG - Intronic
1057064398 9:92035102-92035124 CAGCAGGCACACAGGGCTCATGG - Intronic
1057522498 9:95771263-95771285 GAACAGGCACACAACCCTCTGGG - Intergenic
1059423713 9:114207911-114207933 GAGGAGGCTCAGTGGCTTCTTGG + Intronic
1059666105 9:116448018-116448040 GAGCAGGGACAGAGCCCTAGAGG + Intronic
1059914612 9:119085108-119085130 AAGCAGTCACAGAGGCTTCATGG + Intergenic
1060611687 9:124971743-124971765 AAGCATGCGCAGAGGCCTATGGG - Exonic
1061196410 9:129109517-129109539 GAGCAGGTCCAGGGGACTCTGGG + Intronic
1061316737 9:129801098-129801120 CAGGATGCACAGAGGCCTGTGGG - Intergenic
1061682514 9:132250049-132250071 GAACAGGCACCGAGGTTTCTGGG - Intergenic
1061846182 9:133389643-133389665 GAAAAGGCACTGAGGCCACTCGG + Intronic
1062029821 9:134357184-134357206 GCCCAGGCACTGAGGCGTCTAGG + Intronic
1062285946 9:135772527-135772549 CAACAGGGACAGTGGCCTCTGGG - Intronic
1062385981 9:136311724-136311746 GAGCCCGCACAGACGCCTCAGGG - Intergenic
1062389125 9:136327218-136327240 GTGCAGCCACACTGGCCTCTGGG - Intergenic
1062630303 9:137460298-137460320 GGGCAGGTACAGAGGCCCCTAGG + Exonic
1062657346 9:137611106-137611128 GAGCAGGCACAGAGGAGGGTGGG - Intronic
1062689163 9:137832544-137832566 GAGAAGGCACAGGGGCCACATGG - Intronic
1187287040 X:17915590-17915612 GAGCAGGCACAGAAGTCTCTAGG - Intergenic
1187937982 X:24354324-24354346 GAGCAGGCACAGAGAGCTAAAGG + Intergenic
1188434866 X:30148506-30148528 CAGGAGGCAGACAGGCCTCTGGG + Intergenic
1188781815 X:34295086-34295108 CTGCAGGCACAGAGCCCTCGAGG + Intergenic
1191104638 X:56764851-56764873 GCGTGGGCACAGAGGCCTGTTGG - Intergenic
1192175013 X:68879995-68880017 GACCAGGGAAAGAGGCCCCTGGG - Intergenic
1195614834 X:106903871-106903893 GAGCAGGCCCAGATGCTTGTTGG + Intronic
1197040431 X:121929965-121929987 CAGCAGGGACACAGCCCTCTTGG + Intergenic
1198610498 X:138394537-138394559 AGGTAGGCACACAGGCCTCTTGG - Intergenic
1199448508 X:147954102-147954124 CAGGTGGCACAGAGGCCTCTGGG - Intergenic
1199814376 X:151384937-151384959 CAGCTGGCACAGAGGCAGCTAGG - Intergenic
1200119204 X:153782514-153782536 GAGCAGGCACAGAGGCCTCTCGG - Intronic
1200355852 X:155549887-155549909 GAGCACACACTGGGGCCTCTCGG - Intronic
1200796551 Y:7346192-7346214 GAGGAGCCCCAGAGGGCTCTGGG - Intergenic
1202194051 Y:22277753-22277775 GAGCAGGAGCAGTGGCATCTCGG + Intergenic
1202369750 Y:24188619-24188641 GAACACACACAGAAGCCTCTGGG - Intergenic
1202501035 Y:25481498-25481520 GAACACACACAGAAGCCTCTGGG + Intergenic