ID: 1200122636

View in Genome Browser
Species Human (GRCh38)
Location X:153798346-153798368
Sequence CTGGGTGTCCACTGAGGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200122623_1200122636 27 Left 1200122623 X:153798296-153798318 CCCTGAGCTGGCTTGTGATCTCC 0: 1
1: 0
2: 2
3: 10
4: 158
Right 1200122636 X:153798346-153798368 CTGGGTGTCCACTGAGGTGCTGG 0: 1
1: 0
2: 2
3: 29
4: 202
1200122624_1200122636 26 Left 1200122624 X:153798297-153798319 CCTGAGCTGGCTTGTGATCTCCT 0: 1
1: 0
2: 0
3: 15
4: 164
Right 1200122636 X:153798346-153798368 CTGGGTGTCCACTGAGGTGCTGG 0: 1
1: 0
2: 2
3: 29
4: 202
1200122628_1200122636 6 Left 1200122628 X:153798317-153798339 CCTTTTTTTCAGGGCACTTGGAA 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1200122636 X:153798346-153798368 CTGGGTGTCCACTGAGGTGCTGG 0: 1
1: 0
2: 2
3: 29
4: 202
1200122622_1200122636 28 Left 1200122622 X:153798295-153798317 CCCCTGAGCTGGCTTGTGATCTC 0: 1
1: 0
2: 0
3: 18
4: 153
Right 1200122636 X:153798346-153798368 CTGGGTGTCCACTGAGGTGCTGG 0: 1
1: 0
2: 2
3: 29
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200122636 Original CRISPR CTGGGTGTCCACTGAGGTGC TGG Exonic
900130843 1:1086521-1086543 CTGGGTGTGCTCTGAGATGCTGG + Intronic
900580882 1:3408234-3408256 CTGTGTGGCCAGTGAGGTGGGGG - Intronic
904206635 1:28859674-28859696 TTGGATGTCCAGTGAGGTGAGGG + Intronic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
905889083 1:41508510-41508532 CTGGGAGTCCACTGTGCTCCAGG - Exonic
906754157 1:48292888-48292910 TTGGGTGCCCACAGAGGCGCTGG + Intergenic
906938653 1:50236569-50236591 CAGGGAGGCCACTGAGGTGAAGG - Intergenic
907771554 1:57470158-57470180 CTTGGTCTCCACTGAGGTGCTGG + Intronic
910577753 1:88785518-88785540 CTGGTAGTCCACTGAGATGGGGG + Intronic
912963228 1:114214405-114214427 CTTGGTGTCCAGTGGGGTGCTGG + Intergenic
914673964 1:149893405-149893427 CTGGAAGTCTTCTGAGGTGCTGG + Intronic
915661414 1:157408779-157408801 CAGGTTGTCTTCTGAGGTGCTGG + Intergenic
916861596 1:168811903-168811925 CTGGGTGTAGAATGAGATGCTGG + Intergenic
918044818 1:180935463-180935485 CCGGGTGTCCCCTGCGGTCCAGG - Exonic
918093898 1:181318756-181318778 CTGGGTGTCTATGGAGTTGCGGG + Intergenic
918423058 1:184383837-184383859 CAGGTTGGCCACTAAGGTGCTGG - Intergenic
921172895 1:212565112-212565134 ATGTGTGTCCCCAGAGGTGCTGG + Intergenic
922712706 1:227845388-227845410 CTTGGTGTCCACTGTGGGGCAGG + Intronic
924920559 1:248624975-248624997 CTTGGTCTCCACTAAAGTGCTGG + Intergenic
1064451812 10:15448833-15448855 CTGCGTGTACAGTGAGGAGCAGG - Intergenic
1066237950 10:33505423-33505445 CTAGGTGTTCACTGAGATACGGG - Intergenic
1066478434 10:35771177-35771199 CTGGTTGTCAACTAAGGTGTTGG + Intergenic
1066745301 10:38601387-38601409 CTGGGTGTCCACGGAGGGAAGGG - Intergenic
1067030077 10:42873952-42873974 CTGGTTGCCCCCTGAGGTGCAGG - Intergenic
1067681686 10:48445700-48445722 CTGGGTGCCCACTCAGGCTCTGG + Intergenic
1070657990 10:78284324-78284346 CTGAGTGTCCCCTGTGATGCTGG + Intergenic
1070753758 10:78978961-78978983 CTGGGTATCCACTGAGTGCCAGG - Intergenic
1071727724 10:88216872-88216894 CTGGGTACCCACTGATGTGGGGG + Intergenic
1072595610 10:96868862-96868884 GTGGGTGTCCAGTAAGTTGCTGG + Intronic
1075369888 10:121927421-121927443 GTGGGTGTGCACACAGGTGCCGG - Intronic
1075747377 10:124737122-124737144 CTGGGTGTCCAGTGTGGAGCCGG - Intronic
1076441075 10:130481734-130481756 CTGGGTGTCTAGGCAGGTGCAGG + Intergenic
1076810969 10:132886140-132886162 CCGGGTGGCCACTGTGGGGCTGG - Intronic
1076894421 10:133302871-133302893 CTGCGTGTCCACGGAGGAGATGG - Exonic
1077191853 11:1258985-1259007 CTGGGTGTCCCCAGAGAGGCAGG - Exonic
1078547988 11:12260067-12260089 CTGGGCGTTCTCTGAGGTCCTGG + Intronic
1079094015 11:17499627-17499649 CTGGGTGGGCACTGATGGGCTGG + Intronic
1081289746 11:41309284-41309306 ATTGGTGTCCACTGAGGCACAGG + Intronic
1081742165 11:45448435-45448457 CTGAGTGTCCACTTCGGTGCAGG + Intergenic
1083851512 11:65370355-65370377 CTGGGAAGCCACTGAGGAGCAGG + Intergenic
1083916211 11:65745204-65745226 CTGGGTGTCAGCACAGGTGCCGG - Intergenic
1084360847 11:68667697-68667719 CTGGGTGGCCAGTGGGGTGCTGG - Intergenic
1089837517 11:121384104-121384126 ATTGGTGTACACTGTGGTGCTGG + Intergenic
1091548277 12:1518905-1518927 CTGGGTGTGCACCGTGCTGCAGG - Intergenic
1091813933 12:3421965-3421987 CTGGGAGTGCACTGAGGAGGGGG - Intronic
1096812789 12:54182452-54182474 CAGGCTGTCCACAGAGGTTCCGG + Exonic
1098398096 12:70043628-70043650 CTGGGAGAACACTGAGGTGGAGG + Intergenic
1100738704 12:97567029-97567051 CTTGGTGTTCACTGAGGTTTTGG - Intergenic
1101880633 12:108623284-108623306 CTTCGTGTGCACTGTGGTGCTGG - Exonic
1104835346 12:131786597-131786619 CTGGGTGTGCACGCAGGTGCTGG + Intronic
1106599674 13:31176826-31176848 CTGAGTGTCCACTAAGCTCCAGG + Intergenic
1107376153 13:39806945-39806967 CTGGATGGCCACTGGGTTGCTGG - Intergenic
1114273604 14:21120989-21121011 CTGGCTGGCCACTGGGTTGCAGG + Intergenic
1114992309 14:28301507-28301529 CTTGGGGACCACTGAGGTCCGGG - Intergenic
1117399625 14:55346918-55346940 CTGGATGTGGACTGGGGTGCTGG - Intronic
1118814259 14:69298753-69298775 CTGGGTATCTTCTGTGGTGCTGG + Intronic
1119164174 14:72478702-72478724 ATGTGTGTCCTTTGAGGTGCTGG + Intronic
1119685146 14:76625351-76625373 CTGGGGATCCACCGTGGTGCTGG - Intergenic
1120059541 14:79966340-79966362 CTTGGTATCAGCTGAGGTGCTGG + Intergenic
1121803883 14:96797551-96797573 CTGTGGGTCCACCGGGGTGCGGG + Intronic
1122060891 14:99136098-99136120 CTGGCAGCCCACTGTGGTGCAGG + Intergenic
1122771308 14:104099160-104099182 CTGCGTGGCCACAGAGGTGGGGG + Intronic
1124555010 15:30717380-30717402 CGGTGTGCCCACTGATGTGCTGG - Intronic
1124676238 15:31688299-31688321 CGGTGTGCCCACTGATGTGCTGG + Intronic
1124779369 15:32615522-32615544 CTGGGTGTCTGCGGAGGAGCTGG + Exonic
1126063061 15:44802574-44802596 CTGGCTTTCCACTGAGATGCAGG + Intergenic
1128575346 15:68770525-68770547 ATGGATGTCCACAGAGATGCTGG - Intergenic
1128727182 15:69996943-69996965 CTGTGTGTCCTCTTAAGTGCAGG - Intergenic
1131047700 15:89326613-89326635 CAGGGTGTCCAGGAAGGTGCTGG + Exonic
1131163584 15:90126200-90126222 CAGTTTGTCCAATGAGGTGCTGG + Intergenic
1131911668 15:97212134-97212156 GTGGGTATCCACTGAAATGCAGG - Intergenic
1132595565 16:747679-747701 CTGTGTGGCCACTGATGTGCAGG + Intronic
1132601366 16:774564-774586 CTGGGTGTCCACAGAGGGGCAGG - Intronic
1132798649 16:1740731-1740753 AGGTGTGTCCACTGTGGTGCTGG + Intronic
1132999217 16:2840810-2840832 CTGGGGGTCCACTCAGGAGAGGG - Intergenic
1135190112 16:20347942-20347964 GTGGGTGCCCACTGTGGTGTGGG + Intronic
1135268854 16:21051764-21051786 CTGGGTGGCCAAGGATGTGCAGG - Exonic
1136737767 16:32478262-32478284 CTGGGTGTCCACGGAGGGAAGGG + Intergenic
1137068678 16:35878384-35878406 TTGGGTGTGCGCTGAGGTGGAGG - Intergenic
1139468159 16:67164978-67165000 ATGGGTGTTCACTGACGTGGAGG - Intronic
1141519921 16:84571811-84571833 CTCGGTGTCCACTCAGGAGCAGG - Intronic
1141695169 16:85615669-85615691 CAAGGTGTCCACTGTGGCGCAGG + Intronic
1141932794 16:87217051-87217073 CCTGGTGCCCACTGAGGGGCTGG + Intronic
1142311953 16:89319351-89319373 CTGGGAGTCCACTCAGGAGGTGG + Intronic
1203015306 16_KI270728v1_random:351315-351337 CTGGGTGTCCACGGAGGGAAGGG - Intergenic
1203033641 16_KI270728v1_random:624473-624495 CTGGGTGTCCACGGAGGGAAGGG - Intergenic
1143376426 17:6470277-6470299 CTGGGAGTCCACAGACGTGGTGG - Exonic
1144777941 17:17794156-17794178 CTGGGTGTCCACAGAGCTGGTGG - Exonic
1145302911 17:21653454-21653476 CTGGGTGTCCACCCAGGTTCTGG - Intergenic
1145347130 17:22048387-22048409 CTGGGTGTCCACCCAGGTTCTGG + Intergenic
1146054603 17:29574795-29574817 CTGGAAGTCCACTGGGGCGCCGG + Exonic
1146653653 17:34622595-34622617 CTGGGTGGCCACTGAGGGGAGGG - Intronic
1147261660 17:39212578-39212600 CTGGGTGTCTGCTGACGTGCTGG - Intronic
1147716551 17:42512586-42512608 CTAGGTGTCGACAGAGGTGAGGG + Intronic
1147938137 17:44025432-44025454 CTGGGGCTGCACTCAGGTGCAGG - Intergenic
1148855642 17:50577920-50577942 CTGGATGTCCTCTGAGGTCCTGG - Intronic
1149095733 17:52838260-52838282 CTGTCTGTCAACTGAGGAGCAGG + Intergenic
1149722906 17:58863886-58863908 CTGTGTGTCCACTGAGTTTGGGG + Intronic
1149777524 17:59369873-59369895 CTGGGTGTCTACTAAGGGGCAGG + Intronic
1151449348 17:74188338-74188360 CTGGGTCTCATCTGAGGTTCAGG + Intergenic
1152377757 17:79927537-79927559 CTAGGTGTGCACAGAGATGCTGG + Intergenic
1152941005 17:83172908-83172930 CTGGGTGAGCACTGGGGTGAGGG + Intergenic
1153972032 18:10235742-10235764 CTGGGTTCCCAGTGAGGGGCTGG - Intergenic
1155623460 18:27807773-27807795 CTGGCTGTCCCCTGAGCTGATGG - Intergenic
1157574127 18:48732393-48732415 CTGGGTGTGCACTGCCCTGCTGG - Intronic
1158996634 18:62927154-62927176 CTGTGTGTCCTCTGATGTTCTGG - Intronic
1159104941 18:63994743-63994765 CTGGGTCTACAATGAGGGGCTGG + Intronic
1164603137 19:29577227-29577249 GTGGCTGTACACTGAGGAGCAGG - Intergenic
1165079673 19:33300166-33300188 CTGGGGGACCAATGAGGTGAGGG - Exonic
1165130621 19:33629655-33629677 CTGAGTGGCCACCGAGCTGCAGG + Intronic
1166035582 19:40165780-40165802 CTGGGTGTGCAGAGAGGCGCTGG - Intergenic
1166665966 19:44680621-44680643 CTGGGAGACCAGTGAGGAGCTGG - Intronic
1167142480 19:47661514-47661536 CTCGGTGTCCAGTGTGGGGCAGG + Intronic
1167267069 19:48488522-48488544 CAGGGGGTGCACTGAGGAGCTGG - Intronic
1167870985 19:52370037-52370059 CTGTGTGACCCCTGAGATGCCGG - Intronic
926315196 2:11704661-11704683 CTGAGTGTACAATGAGGGGCTGG - Intronic
927230816 2:20822830-20822852 CTGGGAGTCCCTTGAGTTGCAGG - Intronic
928082451 2:28323117-28323139 CTGTGTGTCCCCTGAGGGCCAGG + Intronic
928388477 2:30889608-30889630 AGAGGTGTACACTGAGGTGCAGG + Intergenic
929018585 2:37527175-37527197 CTGGGAGGCCACAGAGGAGCAGG + Intergenic
929563693 2:42971348-42971370 CTGAGTGTCCACTGGGGTGAGGG - Intergenic
929657818 2:43751596-43751618 CTGGGTGTCCAATGAGGAGGTGG + Intronic
932794110 2:74680251-74680273 CGGAGTGACCACTGAGATGCTGG + Exonic
932801408 2:74745637-74745659 CAGGGTGGCCGCTGAGGTGTAGG + Intergenic
934188889 2:89767375-89767397 CTGGGTGTCCACAGAGGGAAGGG + Intergenic
934307702 2:91840578-91840600 CTGGGTGTCCACGGAGGGAAGGG - Intergenic
935703782 2:105838710-105838732 CTGTGTGTCTACTGTGGTGATGG + Intronic
937204543 2:120227049-120227071 CTGAATGTCCTCTGAGGGGCTGG + Intergenic
937226698 2:120374499-120374521 CTGGGGGTCCACTGAGATCCCGG + Intergenic
938736351 2:134190058-134190080 TTGGGAATCCACTGAGTTGCTGG + Intronic
942832866 2:180257405-180257427 CTGAGTGTGTACTGAGGTCCAGG + Intergenic
943168045 2:184357470-184357492 CTGGGTGTAGAGTGGGGTGCGGG + Intergenic
943781211 2:191825903-191825925 CAGGGTGCTCCCTGAGGTGCAGG + Intergenic
947311282 2:228806321-228806343 TTTGGTGTCCACGGAGGTCCTGG + Intergenic
948080471 2:235201606-235201628 CTGGGTGTGAAGTGAGATGCTGG - Intergenic
948844479 2:240676614-240676636 CTGGGTGTCCCCTGAGGCCGGGG + Exonic
948849381 2:240698265-240698287 CTGGGTGTCCCCTGAGGCCGGGG - Exonic
948929950 2:241125805-241125827 CTGTGTGACCACTGAGGTGGGGG + Intronic
949070297 2:242020417-242020439 CTGGACGTCCACGGAGGAGCTGG + Intergenic
1170539251 20:17371327-17371349 CTGGGGTTCCAGTGAGCTGCAGG + Intronic
1171090061 20:22276551-22276573 CTCGGTGCCCACGGAGGAGCTGG - Intergenic
1171204538 20:23268512-23268534 CTGGGTGTCCAGGGCTGTGCTGG - Intergenic
1171520436 20:25771145-25771167 CTGGGTGTCCACCCAAGTTCTGG - Intronic
1171556483 20:26085348-26085370 CTGGGTGTCCACCCAAGTTCTGG + Intergenic
1172993392 20:39052236-39052258 CTGGGTGTGCAGTGAGGGGTGGG + Intergenic
1173220905 20:41132280-41132302 CTGGCTGTGTGCTGAGGTGCAGG + Intergenic
1174696821 20:52568147-52568169 ATGGGGGTCAACTGAGGTGAAGG + Intergenic
1176047620 20:63100959-63100981 CAGGGTGTCCACTGGGGGACGGG + Intergenic
1179278557 21:39913947-39913969 CTGGCTGTCAACTCAGCTGCTGG - Intronic
1179283680 21:39956790-39956812 CTGAGTGTCTGCAGAGGTGCCGG - Intergenic
1179714896 21:43281575-43281597 CTTGATTTCCACTGAAGTGCAGG - Intergenic
1180014101 21:45071863-45071885 CTGGGTCTCCACAGAAGTGCTGG - Intergenic
1180595054 22:16967605-16967627 CTGGGTGACCACCAAGCTGCAGG + Intronic
1181809173 22:25393024-25393046 CCAGGTGTCTCCTGAGGTGCAGG + Intronic
1182078313 22:27510473-27510495 CTGGATGTGCACAGTGGTGCTGG + Intergenic
1182295548 22:29309709-29309731 CTGGGTGGGCACTGATGTGGAGG - Intronic
1184595579 22:45512105-45512127 GTGGGTGTCCAGTGTGGTACTGG + Intronic
1184829440 22:46974900-46974922 CAGGGTCCCCACTGTGGTGCAGG - Intronic
952525005 3:34200713-34200735 CTGGCTTTCCACTGAGATGCAGG - Intergenic
953391688 3:42537470-42537492 CTGAGTGGCCACTGGGGTGAAGG - Exonic
954129937 3:48555520-48555542 CTAGATGTTCTCTGAGGTGCTGG + Intronic
954132758 3:48568696-48568718 CTGGGGGTCCTCTTAAGTGCTGG - Intronic
956344557 3:68263737-68263759 CTGGGTGCCCAGTGCTGTGCTGG - Intronic
956401074 3:68880730-68880752 CTGCATGTCCCCGGAGGTGCTGG + Exonic
956423819 3:69112343-69112365 CTGGACATCCACTGAGGTGTTGG - Intronic
956906799 3:73774309-73774331 CTGGGTTCCTACTGAGTTGCAGG + Intergenic
960125308 3:113992139-113992161 CAGTGTGTCCAGTGATGTGCTGG - Intronic
960995709 3:123338910-123338932 CTGGGTGTCCAGGGTGCTGCAGG - Intronic
962329365 3:134464049-134464071 CTGTGACTCCACTGGGGTGCTGG + Intergenic
968642948 4:1723638-1723660 CTTGGTGACCTCTGAGCTGCAGG + Intronic
968938715 4:3626894-3626916 CCAGGTGTTGACTGAGGTGCTGG - Intergenic
972148896 4:36064598-36064620 GTGGGTGTACTCTGAGGTGGAGG + Intronic
974351340 4:60750799-60750821 CTGGCTGTCAGCTGAGGTGAAGG - Intergenic
980625728 4:135372362-135372384 CAGGGTGTCCACTGTGCTACTGG + Intergenic
981941592 4:150287227-150287249 GTGGGTTTCCCCTGAGCTGCTGG - Intronic
982798661 4:159674557-159674579 ATGGGTGGGAACTGAGGTGCAGG - Intergenic
985078366 4:186241134-186241156 CTGGGTGTTCCCTGAGGAACGGG - Intronic
985629293 5:1006402-1006424 CTGGGAGTCCTCTGAGGTAGAGG - Intergenic
987100040 5:14582866-14582888 CTGGGAGTTCAGTCAGGTGCTGG + Intronic
987148754 5:15017756-15017778 GTGGGGGTCCACTGGGGGGCAGG + Intergenic
987416776 5:17670569-17670591 CTTGATGTCCACTGTGGTGCAGG + Intergenic
996266478 5:121547144-121547166 CTGTGAGTCCTCTGAGGTTCAGG - Intergenic
1001982208 5:176045059-176045081 CCTGGTGTCCACGTAGGTGCTGG + Intergenic
1002235253 5:177798998-177799020 CCTGGTGTCCACGTAGGTGCTGG - Intergenic
1002581647 5:180212484-180212506 CTGGGTGTCGACACAGGGGCAGG + Intergenic
1002954379 6:1847490-1847512 ATGAATGTCCACTGAGGTGATGG - Intronic
1003303237 6:4903730-4903752 CTTGGTGTCCACACAGTTGCTGG + Intronic
1005890326 6:30132058-30132080 CTGGGCTTCCACTGATGTGAAGG + Intergenic
1006449446 6:34097721-34097743 CCGGGTGGGCACTGAGATGCTGG - Intronic
1006569061 6:34985320-34985342 CTGGCTGGCCCCTGAGGTGATGG + Intronic
1006841908 6:37033870-37033892 CTCCCTGTCCAGTGAGGTGCTGG - Intergenic
1014088802 6:117378938-117378960 CTGGTTATCCACTGTGTTGCAGG - Intronic
1015573001 6:134641386-134641408 CTGGGAGCCCTCTGGGGTGCTGG + Intergenic
1017749877 6:157481418-157481440 CTGGTTGTACAGTGAGGTGCTGG + Intronic
1019172707 6:170142981-170143003 CTGGGTGGCTCCTGGGGTGCAGG + Intergenic
1019232537 6:170580338-170580360 TTGGGTGTCCTGTGATGTGCTGG - Intronic
1019587320 7:1812684-1812706 TTGGGTGCCCACTAAGGAGCTGG + Intergenic
1021078293 7:16331978-16332000 CTTGGTGTTCACTGAGCTTCTGG - Intronic
1022299869 7:29092954-29092976 CAGGGTCTCCACTGAGGCACAGG - Intronic
1025280929 7:57626109-57626131 CTGGGTGTCCACCCAGGTTCTGG - Intergenic
1025303801 7:57839398-57839420 CTGGGTGTCCACCCAGGTTCTGG + Intergenic
1029103853 7:98157868-98157890 CTGAGTCTCCATTGAGGTGGTGG + Intronic
1034298379 7:149993837-149993859 CAGGGTGTCCTCTGAGGGCCTGG - Intergenic
1034807634 7:154102945-154102967 CAGGGTGTCCTCTGAGGGCCTGG + Intronic
1034893314 7:154859136-154859158 CTCTGTGACCACTGAGCTGCTGG + Intronic
1035204212 7:157284278-157284300 CAGGGTGTCCAGTCAGGAGCTGG - Intergenic
1035204930 7:157289160-157289182 CTGGGCTTCCACTGTGGAGCTGG + Intergenic
1035860173 8:3019954-3019976 CTAGGTGAGCACTGATGTGCAGG + Intronic
1037504455 8:19516403-19516425 CTGGGTGTAGAATGAGGAGCAGG - Intronic
1038419643 8:27424526-27424548 CTGGTTGACCACTGAAATGCCGG + Intronic
1047898078 8:129388919-129388941 CTGGATGGGGACTGAGGTGCGGG + Intergenic
1048292568 8:133191906-133191928 CTTGGTGTACCCTGGGGTGCAGG - Intronic
1048454821 8:134568048-134568070 CTGTGTGTGCACTCATGTGCTGG - Intronic
1049301947 8:141875398-141875420 CTGGGGGCGCACAGAGGTGCTGG + Intergenic
1050427550 9:5527250-5527272 CTGGATGTTCACTGTGGTGGTGG - Intronic
1053423564 9:37996604-37996626 CAGAGTGTCCACTGATGTGCTGG + Intronic
1055001077 9:71449014-71449036 CTGAGTATGCACTGATGTGCTGG - Intergenic
1060396869 9:123322398-123322420 CTGGGCTTGCACTGTGGTGCTGG + Intergenic
1060473845 9:123970624-123970646 ATGGGGCTCCACTGAGGAGCAGG + Intergenic
1060551808 9:124489170-124489192 TTGGGTGTCCCCTGAAGGGCAGG - Intronic
1060778743 9:126396057-126396079 CTGGGTTTCAAATGAGTTGCTGG - Intronic
1060972153 9:127744534-127744556 CTGGCTGTGCACTGGGGTGGAGG - Intronic
1062598719 9:137310726-137310748 CTGGGTGCCCACTGAGAGCCAGG + Intronic
1185465244 X:350726-350748 CTGGGTGTCCTCCGCGTTGCTGG + Intronic
1186351235 X:8741963-8741985 CTTGGTGTCCACTTGGGTGAGGG + Intergenic
1186509491 X:10119915-10119937 CTGGGTGTCCCCAGAGGGCCGGG + Intronic
1186897680 X:14020699-14020721 CTTGGTGTCCACTGTGGGCCTGG - Intronic
1194401802 X:93446609-93446631 CTGGGTGGCCTCTGAGTGGCTGG + Intergenic
1197512688 X:127390253-127390275 CAGGGTGACCACAGAGGTCCTGG + Intergenic
1199241647 X:145554316-145554338 CTGGTTAGCCACTGTGGTGCAGG - Intergenic
1199569952 X:149257219-149257241 CTGGGTAACCATTGAGGAGCAGG + Intergenic
1200032422 X:153307146-153307168 AGGAGTGGCCACTGAGGTGCAGG + Intergenic
1200110916 X:153740540-153740562 CTGGGTGTCCACGGAGGGAAGGG - Intronic
1200122636 X:153798346-153798368 CTGGGTGTCCACTGAGGTGCTGG + Exonic