ID: 1200124686

View in Genome Browser
Species Human (GRCh38)
Location X:153807713-153807735
Sequence CTGGGGGCGTTGCATGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 135}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200124686_1200124702 18 Left 1200124686 X:153807713-153807735 CCCCACTCATGCAACGCCCCCAG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1200124702 X:153807754-153807776 AGGACTTCTGCAGAGCAGAGGGG 0: 1
1: 0
2: 3
3: 39
4: 310
1200124686_1200124704 20 Left 1200124686 X:153807713-153807735 CCCCACTCATGCAACGCCCCCAG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1200124704 X:153807756-153807778 GACTTCTGCAGAGCAGAGGGGGG 0: 1
1: 0
2: 7
3: 36
4: 325
1200124686_1200124694 -5 Left 1200124686 X:153807713-153807735 CCCCACTCATGCAACGCCCCCAG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1200124694 X:153807731-153807753 CCCAGGAGTTATCCAGGCCCTGG 0: 1
1: 0
2: 0
3: 39
4: 664
1200124686_1200124696 -2 Left 1200124686 X:153807713-153807735 CCCCACTCATGCAACGCCCCCAG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1200124696 X:153807734-153807756 AGGAGTTATCCAGGCCCTGGAGG 0: 1
1: 0
2: 4
3: 14
4: 190
1200124686_1200124700 16 Left 1200124686 X:153807713-153807735 CCCCACTCATGCAACGCCCCCAG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1200124700 X:153807752-153807774 GGAGGACTTCTGCAGAGCAGAGG 0: 1
1: 0
2: 0
3: 26
4: 292
1200124686_1200124701 17 Left 1200124686 X:153807713-153807735 CCCCACTCATGCAACGCCCCCAG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1200124701 X:153807753-153807775 GAGGACTTCTGCAGAGCAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 304
1200124686_1200124703 19 Left 1200124686 X:153807713-153807735 CCCCACTCATGCAACGCCCCCAG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1200124703 X:153807755-153807777 GGACTTCTGCAGAGCAGAGGGGG 0: 1
1: 0
2: 4
3: 32
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200124686 Original CRISPR CTGGGGGCGTTGCATGAGTG GGG (reversed) Intronic
901921515 1:12540658-12540680 CTGGGTGCGGTGCATGGGGGTGG + Intergenic
902239550 1:15079539-15079561 CTGGGGGCGATGGATGGCTGTGG - Intronic
902375076 1:16026782-16026804 CAGGGGGCGGGGCATGAGGGGGG - Intronic
908389108 1:63669469-63669491 CTGGGGGCATTGAAGGAGGGCGG - Intergenic
913220321 1:116654761-116654783 CTGGGGATGTTGCTTGTGTGTGG - Intronic
920660145 1:207908591-207908613 CTGGGGGTGTTGTTAGAGTGAGG + Intronic
923762619 1:236860511-236860533 CTGGGGACCTTGGAGGAGTGGGG + Intronic
924215120 1:241813110-241813132 ATGGGGGCTATGCATGTGTGGGG - Intergenic
1066337862 10:34498273-34498295 CTGAGGGAGATGCATAAGTGTGG + Intronic
1067807858 10:49405712-49405734 CGGGGGGCATTTCAGGAGTGAGG - Intergenic
1067819025 10:49510448-49510470 ATGGTGGTGCTGCATGAGTGAGG - Intronic
1069334208 10:67328627-67328649 CTGGGGGCCAGGAATGAGTGTGG + Intronic
1069986981 10:72291171-72291193 CTGGGGGTGGTGCATGAGGCTGG + Intergenic
1071292994 10:84200900-84200922 CTGGGGACGTTGGAAGAGGGAGG - Intronic
1075297344 10:121289705-121289727 CTGGGGGCTTTGTGTGTGTGTGG - Intergenic
1075941708 10:126395688-126395710 CTGGGGGACTTGCAGCAGTGGGG - Intergenic
1076114232 10:127884343-127884365 CTGGGGTAATTGCATGAGTCAGG + Intronic
1077268494 11:1664286-1664308 CTGGGGGCCTTCCATCTGTGGGG - Intergenic
1077272385 11:1687332-1687354 CTGGGGGCCTTCCATCTGTGGGG + Intergenic
1077404875 11:2378338-2378360 CTGGAGGCCTCGCAGGAGTGGGG + Intronic
1079101428 11:17544415-17544437 CTGGGGGCGGGGCCTGAGCGCGG + Intronic
1084614480 11:70226541-70226563 TTGGGGGCTTGGCATGGGTGTGG + Intergenic
1089650608 11:119910505-119910527 CTGGGAGGGTTTCAGGAGTGGGG - Intergenic
1096788290 12:54030290-54030312 GTGGGGGCGTCGAAGGAGTGGGG - Exonic
1097683816 12:62673817-62673839 ATGGGAGGGTTGCTTGAGTGTGG - Intronic
1101351142 12:103930626-103930648 CTGGGGGCGTTGAACGTGGGAGG + Intronic
1104091179 12:125519082-125519104 TTGGGGGCCTTTCCTGAGTGTGG + Intronic
1104142422 12:126001698-126001720 TTGGGGTGGTTGCATGTGTGTGG - Intergenic
1107058398 13:36130909-36130931 CCGGGGGCGTTGCGTGCGGGCGG - Intronic
1113074854 13:106458083-106458105 GTGGGGGCTTTGCATGCGTGGGG + Intergenic
1113741890 13:112716748-112716770 TTGGGGGCTCTGCGTGAGTGGGG + Intronic
1117070142 14:52048818-52048840 CTGGAGGTGTTGAAGGAGTGAGG + Intronic
1118764144 14:68898920-68898942 CTGTGGGTGTGGCATGTGTGAGG - Intronic
1122324211 14:100873148-100873170 CTCAGGGCAATGCATGAGTGGGG - Intergenic
1122773050 14:104105694-104105716 CTGGCGGCGCTGCCTTAGTGCGG + Intronic
1123493026 15:20798206-20798228 CTGGGGGTGTTACCTGAATGAGG + Intergenic
1123509708 15:20984779-20984801 CTGGGGGCTTTTCAGGGGTGGGG + Intergenic
1123549532 15:21367308-21367330 CTGGGGGTGTTACCTGAATGAGG + Intergenic
1123566928 15:21558518-21558540 CTGGGGGCTTTTCAGGGGTGGGG + Intergenic
1123603192 15:21995811-21995833 CTGGGGGCTTTTCAGGGGTGGGG + Intergenic
1125978460 15:43977434-43977456 CTGGGGGTGGTGCATGGGGGAGG + Intronic
1126532165 15:49723006-49723028 CTGGGGCTGTTGCATGCATGTGG - Intergenic
1126766896 15:52019023-52019045 CTGGGGGCTTTGCCTGCGGGCGG - Intronic
1130798812 15:87239292-87239314 CTGGGGGCATAGCATGAGGAGGG + Intergenic
1131982725 15:98010998-98011020 TTTGGGGGGTTGCATGAGTGGGG - Intergenic
1202957863 15_KI270727v1_random:94526-94548 CTGGGGGTGTTACCTGAATGAGG + Intergenic
1202975289 15_KI270727v1_random:285612-285634 CTGGGGGCTTTTCAGGGGTGGGG + Intergenic
1133734880 16:8607407-8607429 CTGGGGGAGTTGGATGTGGGAGG - Intergenic
1133931210 16:10233564-10233586 CTGGGCTCATTGCATGAGGGAGG - Intergenic
1135990683 16:27216871-27216893 CTGGGGGCATGGCCTCAGTGTGG + Intronic
1139832481 16:69811194-69811216 CTGGGAGAGCTGCAGGAGTGGGG - Intronic
1141698615 16:85632362-85632384 CTGGGGGCACTGCCTGAGAGAGG - Intronic
1141891455 16:86929304-86929326 CGGGGGACGATGGATGAGTGTGG - Intergenic
1142138413 16:88461885-88461907 CTGGAGGCGTGACATGTGTGAGG + Intronic
1143096930 17:4483147-4483169 CTGGGGGCGAGGCCTGGGTGGGG + Intronic
1143102434 17:4511870-4511892 CTGGGGGTGTGGAAGGAGTGGGG - Intronic
1143496356 17:7315026-7315048 CTTGGGGCGCTCCAGGAGTGCGG + Exonic
1148011522 17:44485652-44485674 CTGGGGGCATAGGAAGAGTGTGG - Intronic
1148875699 17:50685872-50685894 CTGGGGAGGGTGCATGAGTATGG - Intronic
1154177536 18:12094678-12094700 CTGGGGGCGTTGGATGTTGGGGG + Intronic
1154374766 18:13799702-13799724 CTGGGCTCGGTGAATGAGTGCGG - Intergenic
1160573135 18:79832072-79832094 CAGGGGGCGGTGGGTGAGTGTGG - Intergenic
1160805773 19:991671-991693 CTGGGGGCGTGGACTGACTGTGG + Intronic
1161016333 19:1985573-1985595 GTGGGGGCGTGGCCGGAGTGGGG + Exonic
1162906272 19:13825909-13825931 CTGGGGGCGTGGCCTGAGTGTGG + Intronic
1163828816 19:19538198-19538220 CAGGGGGCGTGGCCTGAATGGGG + Intergenic
1163838752 19:19592866-19592888 CTGGGTCCCTTTCATGAGTGAGG + Intronic
1166869723 19:45864132-45864154 CTGGGGGTGATTCAGGAGTGAGG - Intronic
1168726178 19:58583360-58583382 CTGGGGGCATGGCAGGAGTCCGG - Intergenic
925984681 2:9206546-9206568 CTGGGGGCGGGGCATGGGCGCGG + Intergenic
926123425 2:10256958-10256980 CAGGGGGCGCTGCGTGAGGGAGG - Intergenic
928313539 2:30230012-30230034 CTGGGGGTGTTGCCTGATGGAGG - Intergenic
928948155 2:36790549-36790571 CTGGAGGCGTGTGATGAGTGTGG - Intronic
932126305 2:69148245-69148267 CTGGGAGCACAGCATGAGTGCGG - Intronic
932416639 2:71577509-71577531 GTGGGGGGGCTGCATGAGAGTGG - Intronic
935230837 2:101094453-101094475 GTGGGGGTGTGGGATGAGTGGGG - Intronic
937046849 2:118856233-118856255 CTGAGGGCGTTGGATGAGATTGG + Intergenic
937120406 2:119436835-119436857 CTGGGGGCGTGGCAGGGCTGTGG + Intronic
938201078 2:129373512-129373534 CTGTGGACTTTGCCTGAGTGAGG + Intergenic
938578905 2:132628458-132628480 CTGCTGGCCCTGCATGAGTGAGG - Intronic
939096249 2:137836794-137836816 CTGGGGGTGGTGAATGTGTGAGG - Intergenic
942233403 2:173880687-173880709 CTGCAGGCAGTGCATGAGTGTGG - Intergenic
942844630 2:180408348-180408370 CTGGGGGCGGGGAATGAGGGTGG - Intergenic
944926847 2:204474259-204474281 CTGGGGGCTTTCCCTGAGTCTGG - Intergenic
946627447 2:221628972-221628994 CTGGGGGTGTTACATGAGACCGG + Intergenic
1169542417 20:6614463-6614485 CTGGGGTGGGTGCAAGAGTGTGG - Intergenic
1169758542 20:9068033-9068055 CTGGGGGATTTGCATGTCTGAGG + Intergenic
1176370351 21:6058544-6058566 TTGGGGGCCTTGCATCTGTGTGG + Intergenic
1178599556 21:33984156-33984178 CTGGGGGCATTCCATCTGTGAGG + Intergenic
1179677003 21:42990002-42990024 GTGGGAGGGTTGCTTGAGTGAGG + Intronic
1179753168 21:43479997-43480019 TTGGGGGCCTTGCATCTGTGTGG - Intergenic
1181270728 22:21657275-21657297 CTCGGGGCGTTGCCTGGATGAGG + Intronic
1181954641 22:26579444-26579466 CTGGGGGCGTGGAAAGGGTGTGG + Intronic
1184415318 22:44348833-44348855 CCGGGGTCGTGGCATGCGTGGGG - Intergenic
1185181923 22:49368666-49368688 CTGGGGGCTGTGCAGGAGTGGGG - Intergenic
950419867 3:12892530-12892552 CTGGGGGGGGTGCAGGGGTGGGG - Intergenic
950427951 3:12934832-12934854 CTTGGGGAGATGCATGAGTTGGG - Intronic
952890547 3:38037383-38037405 CTGGGGGCCTTGCATGCTTGTGG + Intergenic
953703350 3:45213421-45213443 CTTGGGGAGCTGTATGAGTGGGG + Intergenic
957492289 3:80944001-80944023 CTTGAGGCCTTGGATGAGTGAGG - Intergenic
960091734 3:113646934-113646956 CTGGGGATGTTGGATGAGTCTGG - Intergenic
962925338 3:139988112-139988134 CTGGGGGCATTTGCTGAGTGCGG + Intronic
970193858 4:13538016-13538038 CTGGGGGCTTTTGAGGAGTGGGG - Intergenic
974232519 4:59135501-59135523 CTGGAGGTGTGGCATCAGTGTGG + Intergenic
979769709 4:124507859-124507881 TTGGGGGCATGGCATCAGTGCGG - Intergenic
983209611 4:164945377-164945399 GTGGGGGCTTTGTAGGAGTGTGG - Intergenic
983580462 4:169304706-169304728 ATGGGTGAGTTGCATGAATGGGG + Intergenic
984842421 4:184080688-184080710 CTGGGGTGGTTCCCTGAGTGCGG - Intergenic
985537900 5:474870-474892 CCGGGAGCGTTACATGTGTGTGG + Exonic
985605689 5:857002-857024 CTGTGGGGGTTGTATGTGTGCGG - Intronic
986757956 5:10855409-10855431 CTGGGGACTTTGGAGGAGTGTGG + Intergenic
986818835 5:11443363-11443385 GGGGGGGTGTGGCATGAGTGGGG + Intronic
988664579 5:33311393-33311415 TTGGGGGAGTGGCAGGAGTGGGG - Intergenic
998366681 5:141636925-141636947 CTGGGGGCGTGGCCTGGGTGTGG - Intergenic
1001972455 5:175967707-175967729 CTGGGGGCGTGTGAAGAGTGTGG - Intronic
1002244984 5:177876073-177876095 CTGGGGGCGTGTGAAGAGTGTGG + Intergenic
1006315485 6:33289034-33289056 CGGGGGGCGGGGCGTGAGTGCGG - Intronic
1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG + Intronic
1017819430 6:158038716-158038738 ATGGGGGCGCAGCAGGAGTGGGG + Intronic
1018631508 6:165826560-165826582 CTGGGGGCGTGGCGGGAGCGTGG - Intronic
1019390425 7:783698-783720 CTGGGGGCGTTGCGTGGATCTGG - Intronic
1019995406 7:4721238-4721260 GTGGGGGCTTTGCCTGTGTGTGG + Intronic
1022830413 7:34059894-34059916 CTGGGGGAGTTGCAGGATGGGGG - Intronic
1024672478 7:51608533-51608555 CTGGGGGCGGTGCATGTGCCAGG + Intergenic
1024797414 7:53036016-53036038 CTGGGAGGGTTGCATGAAAGGGG + Exonic
1025237783 7:57246221-57246243 CTGGGGCCTTTGGAGGAGTGTGG - Intergenic
1027898055 7:84070781-84070803 CTGGGGGCTGAGGATGAGTGAGG - Intronic
1029494050 7:100887792-100887814 CTGGGCGCTTAGCATCAGTGAGG - Exonic
1029622265 7:101697653-101697675 CTCAGGGTGTTGCAGGAGTGTGG + Intergenic
1032476922 7:132217851-132217873 GTGGGGGTGGTGCATGGGTGGGG + Intronic
1033152163 7:138924955-138924977 CTGGGAGCGGTGCAGGAGTCCGG - Intronic
1034423786 7:151002499-151002521 CTGGGAGCGTAGCTTGTGTGGGG - Intronic
1034924930 7:155113589-155113611 CTGGGGGTGTTGTATGACTAGGG + Intergenic
1035404281 7:158587884-158587906 CCGGGGGCGTGGCCTGAGGGCGG - Intergenic
1037834061 8:22205970-22205992 CTGGGAGGGTAGCAGGAGTGGGG + Intronic
1045454803 8:102367442-102367464 CTGGGGGCGGGGCTGGAGTGGGG - Intronic
1049288681 8:141790473-141790495 CTGGCAGCCCTGCATGAGTGTGG - Intergenic
1055240025 9:74172518-74172540 TTGGGGGCCTTGCATGAATTTGG + Intergenic
1195536607 X:106014604-106014626 CTGGGGCTGAGGCATGAGTGAGG - Intergenic
1197723088 X:129758299-129758321 GTGGGGGCGTTGCTGGAATGGGG + Intronic
1198315864 X:135465352-135465374 CTGGGGGAGTGGCATGATTCTGG - Intergenic
1200057985 X:153471505-153471527 CTGGGGGCTTTGCAGGTCTGGGG - Intronic
1200124686 X:153807713-153807735 CTGGGGGCGTTGCATGAGTGGGG - Intronic