ID: 1200125594

View in Genome Browser
Species Human (GRCh38)
Location X:153812738-153812760
Sequence GTGGCTCCTTACCATGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 342}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200125594 Original CRISPR GTGGCTCCTTACCATGTGCC TGG (reversed) Intronic
900704157 1:4068423-4068445 GTGTGCCCTTCCCATGTGCCAGG + Intergenic
901079624 1:6576639-6576661 GTGGCTACTCACCATGTAACTGG + Intronic
901202460 1:7474467-7474489 GTGGATGCTTGCCCTGTGCCAGG - Intronic
901904157 1:12393437-12393459 GTGGCTGCATACCAGGTACCAGG + Intronic
901942553 1:12674640-12674662 GTAGCTGCTTACCAAGTGCCAGG + Intergenic
902521558 1:17020692-17020714 TTGGGTGCTTACTATGTGCCAGG + Intronic
902604096 1:17559276-17559298 GTCGATACTTACCATGTACCAGG - Intronic
902718138 1:18286769-18286791 TTGAGACCTTACCATGTGCCAGG - Intronic
903064158 1:20689184-20689206 TTGGCACATTACCACGTGCCGGG - Intronic
903322287 1:22550415-22550437 GTGGACCCCAACCATGTGCCAGG + Intergenic
903695880 1:25206598-25206620 ATGGCACCTTACTATGTGCAAGG + Intergenic
904451297 1:30614087-30614109 GTGACCCCTTCCCATGTGTCAGG - Intergenic
905034968 1:34912165-34912187 GTGAGTCTTTATCATGTGCCAGG - Intronic
905182166 1:36174232-36174254 GTTGATGCTTACCATGTGCCAGG - Intronic
906488428 1:46248723-46248745 GTGAGTACTTACTATGTGCCAGG + Intronic
906655310 1:47543953-47543975 ATGGCTCCTTATCATGCTCCAGG + Intergenic
907096512 1:51786161-51786183 CTGGGTTCTTACTATGTGCCAGG - Intronic
907254215 1:53166091-53166113 CTGGCTGTTTACCATGTGCCAGG + Intergenic
907874533 1:58472926-58472948 GTGGCCACTCACCATGTGCCAGG + Intronic
908335068 1:63114173-63114195 TAGACTGCTTACCATGTGCCAGG + Intergenic
908400977 1:63772775-63772797 GTGAGTGCTTATCATGTGCCAGG + Intergenic
908570328 1:65403157-65403179 TTGGGGCCTTACTATGTGCCAGG + Intronic
909023585 1:70459368-70459390 GGGACACCCTACCATGTGCCAGG - Intergenic
909576808 1:77185102-77185124 GTGGCTACATACCAGGTACCAGG - Intronic
909696780 1:78476252-78476274 TTGGCTTCTTACCCTGTTCCTGG - Intronic
911721760 1:101198735-101198757 CTGCCTGCTTACTATGTGCCAGG - Intergenic
912130014 1:106588809-106588831 GTGGCTGCATACCAGGTACCAGG + Intergenic
912324567 1:108745653-108745675 GTGCTTACTTACCATATGCCAGG - Intergenic
912370408 1:109169656-109169678 GTGACTCCCCACTATGTGCCAGG + Intronic
912372190 1:109182405-109182427 GTATCTACTTACAATGTGCCAGG + Intronic
912674490 1:111664861-111664883 CTGAGTGCTTACCATGTGCCAGG - Intronic
912710621 1:111947281-111947303 GTGAATGATTACCATGTGCCAGG + Intronic
914341159 1:146761750-146761772 CTGCCTCCTTCCCATGTGGCTGG - Intergenic
916294578 1:163203359-163203381 GTGAATACTTACCAAGTGCCAGG + Intronic
917083825 1:171285377-171285399 CTGGCTCCTTCCCATTTTCCTGG - Exonic
917981466 1:180272166-180272188 GTGGCCCTTTACCATGGGACAGG + Intronic
918569672 1:185974727-185974749 TTGGCTGCTTACCTAGTGCCTGG + Intronic
919930197 1:202216253-202216275 TTGGTTACTTACCATGTGCTAGG + Intronic
920057821 1:203205689-203205711 TTGGCTCCATAACATGAGCCAGG - Intergenic
920421298 1:205835700-205835722 TTGAGTGCTTACCATGTGCCAGG - Intronic
921639481 1:217535053-217535075 TTGGGTCCTTACTATGTGCCAGG - Intronic
921711863 1:218380866-218380888 TGGGGTGCTTACCATGTGCCAGG + Intronic
922019997 1:221694167-221694189 GTGGCTCCTGACCAGGTGCCAGG - Intergenic
922150299 1:222996592-222996614 GTGAGTATTTACCATGTGCCAGG + Intronic
922355340 1:224769812-224769834 TTGAATCCATACCATGTGCCAGG + Intergenic
922945480 1:229510241-229510263 GTGAGTACCTACCATGTGCCAGG + Intergenic
923207314 1:231771536-231771558 TTGGGTGCTTACCATGTACCAGG + Intronic
923809816 1:237300952-237300974 GTGAGTCCTTACAATGTACCAGG - Intronic
1064153723 10:12886627-12886649 GTGGCTCTTTGCCAGTTGCCTGG + Intergenic
1064517745 10:16168992-16169014 GTGGCTGCATACCAGGTACCAGG + Intergenic
1065065767 10:21962254-21962276 TTGGTTGCTTACTATGTGCCTGG - Intronic
1070111309 10:73489451-73489473 TTGAGTACTTACCATGTGCCAGG + Intronic
1072818134 10:98530041-98530063 TTGGATCCTTACCAACTGCCAGG + Intronic
1076039578 10:127232981-127233003 TTGGCTCTTCACCATGTGACTGG + Intronic
1076214584 10:128682796-128682818 GAGGCTCCTTGGCAGGTGCCTGG - Intergenic
1077641940 11:3889103-3889125 GTGAGTGCTTACTATGTGCCAGG + Intronic
1078110151 11:8385713-8385735 TTGGCCACCTACCATGTGCCAGG - Intergenic
1078570060 11:12449968-12449990 ATAGATTCTTACCATGTGCCAGG + Intronic
1079346082 11:19653663-19653685 TTGGGTGCTTACTATGTGCCAGG + Intronic
1080253406 11:30262056-30262078 CTGGATGCATACCATGTGCCAGG + Intergenic
1081110367 11:39127638-39127660 GTGGCTGCATACCAGGTACCAGG - Intergenic
1083541255 11:63512858-63512880 GTGGACACTTACCATGTACCAGG - Intronic
1084903063 11:72324689-72324711 GTGCCAGCTTGCCATGTGCCTGG - Intronic
1085541232 11:77271902-77271924 TTGGATGCTTACTATGTGCCAGG - Intronic
1086185827 11:84014553-84014575 TTGACTACGTACCATGTGCCAGG + Intronic
1087373928 11:97319779-97319801 GTGGCTGCATACCAGGTACCAGG - Intergenic
1087752092 11:102018225-102018247 CTGGATACTTACCATGTGCCAGG + Intergenic
1088327003 11:108610999-108611021 GTGACTCCTCACCATATTCCTGG - Intergenic
1088876058 11:113937372-113937394 TTGAGTTCTTACCATGTGCCAGG + Intronic
1089289964 11:117431645-117431667 GTGGACCCTGACCAAGTGCCAGG - Exonic
1090328589 11:125910652-125910674 GTGGGTCCTTACTACGTGCCAGG - Intronic
1090329332 11:125918281-125918303 GTGCTTGCTTCCCATGTGCCAGG - Intronic
1090681456 11:129062778-129062800 GTGAGTGCTTACCATGTGCCAGG + Intronic
1091028852 11:132165513-132165535 TTGGGTCCTTTCCATGTGACAGG + Intronic
1091788820 12:3259444-3259466 CTGAGCCCTTACCATGTGCCTGG + Intronic
1092093183 12:5820878-5820900 GTGGCTGCATACCAGGTACCAGG - Intronic
1092448212 12:8577702-8577724 TAGGGTCCTCACCATGTGCCAGG + Intergenic
1094630891 12:32172738-32172760 TTGTGTGCTTACCATGTGCCAGG + Intronic
1095417521 12:41992792-41992814 GTAAGTGCTTACCATGTGCCAGG - Intergenic
1096071659 12:48778815-48778837 TTGGCTGCCTACCATATGCCAGG + Intronic
1097018689 12:56005022-56005044 GTGGCTCCTTTCCATGCTCATGG - Exonic
1097300162 12:58009553-58009575 GTGTTTCCTTTCCATGTGGCTGG + Intergenic
1097599974 12:61679070-61679092 TTGGCTGCTTACCGTGTGCCAGG - Intergenic
1097961775 12:65538672-65538694 TTGGGTACTCACCATGTGCCAGG + Intergenic
1099283878 12:80690485-80690507 TTGAATCATTACCATGTGCCGGG + Intergenic
1100707733 12:97219832-97219854 TTGTGTCCCTACCATGTGCCAGG - Intergenic
1100776234 12:97978264-97978286 ATGTATCCTTACCATGTGCTGGG - Intergenic
1101353155 12:103951954-103951976 CTGACTCTCTACCATGTGCCTGG + Intronic
1101440909 12:104703746-104703768 GTGTGTGCTTAGCATGTGCCTGG - Intronic
1101534774 12:105606885-105606907 GTGGCTACATACCAGGTACCAGG + Intergenic
1101596931 12:106176079-106176101 ATAGCTACCTACCATGTGCCAGG + Intergenic
1101673907 12:106900397-106900419 TTGATTGCTTACCATGTGCCTGG - Intergenic
1101717862 12:107326678-107326700 GTGGCACCTCACCATGGTCCAGG + Intronic
1101993515 12:109507354-109507376 GTGGGTGCTGACTATGTGCCAGG - Intronic
1102026724 12:109717931-109717953 GTGGCTCCTGATTAGGTGCCAGG + Intronic
1102044904 12:109823484-109823506 GTGGCTCCTACCCAGGGGCCGGG - Intronic
1102389920 12:112541392-112541414 TTGCCTGCTCACCATGTGCCAGG + Intergenic
1102557535 12:113737473-113737495 TTGGGCCCTTACCCTGTGCCAGG + Intergenic
1105597146 13:21849548-21849570 ATGGCTCATTACCACGTGCAAGG + Intergenic
1105708405 13:22982784-22982806 CTGGCTCCATAACTTGTGCCAGG - Intergenic
1106821802 13:33473117-33473139 GTGGGTGCATCCCATGTGCCAGG + Intergenic
1107983677 13:45756747-45756769 GTGGCTACATACCAGGTACCAGG + Intergenic
1108715740 13:53076199-53076221 TTGAGTACTTACCATGTGCCAGG - Intergenic
1110184715 13:72658895-72658917 CTGATACCTTACCATGTGCCAGG - Intergenic
1112615632 13:101002145-101002167 TTGACTCCCTACTATGTGCCAGG - Intergenic
1113472211 13:110555133-110555155 GTGGGTCCCTGCCACGTGCCAGG - Intronic
1114722089 14:24893252-24893274 GTGAGTGCTTATCATGTGCCAGG + Intronic
1115819303 14:37197131-37197153 GTGACCACATACCATGTGCCAGG - Intergenic
1116531549 14:45978982-45979004 GTGGCTGCATACCAGGTACCAGG + Intergenic
1116569749 14:46500498-46500520 CTGGGTGCATACCATGTGCCGGG - Intergenic
1118329436 14:64804080-64804102 TTGATCCCTTACCATGTGCCAGG + Intronic
1118336292 14:64856009-64856031 GTGTGTCCTTGCCATCTGCCAGG - Intronic
1120513603 14:85444765-85444787 GTGCAACCATACCATGTGCCTGG - Intergenic
1120548180 14:85836028-85836050 CTGGCTCCTTTCAATCTGCCAGG + Intergenic
1124351089 15:28956127-28956149 GTGGTTGGTTACCATGTGCAGGG + Intronic
1125592426 15:40863133-40863155 GTGGCCCCTCACCTTCTGCCTGG - Intergenic
1126093354 15:45070662-45070684 TTGGGTACCTACCATGTGCCAGG + Intronic
1126769198 15:52038207-52038229 CTGAATGCTTACCATGTGCCAGG - Intronic
1127916699 15:63460824-63460846 GTGGGTCCCTATTATGTGCCAGG + Intergenic
1128599071 15:68980223-68980245 TTGGACCCTTTCCATGTGCCAGG + Intronic
1130327264 15:82890987-82891009 GTGCCTACCTACTATGTGCCAGG + Intronic
1131305591 15:91240350-91240372 CTGGATCCTTACTGTGTGCCAGG - Intronic
1131969115 15:97874646-97874668 GTGAGTGCTTACCATGTGCTAGG + Intergenic
1132272071 15:100535364-100535386 CTGGGTTCATACCATGTGCCAGG + Intronic
1133501000 16:6366611-6366633 ATAACTACTTACCATGTGCCAGG + Intronic
1133971666 16:10572551-10572573 TTGGCCGCTTACTATGTGCCGGG - Intronic
1134564782 16:15241818-15241840 GTTGCTGCATACCAGGTGCCTGG + Intergenic
1134737716 16:16514881-16514903 GTTGCTGCATACCAGGTGCCTGG - Intergenic
1134929786 16:18197278-18197300 GTTGCTGCATACCAGGTGCCTGG + Intergenic
1135039670 16:19108414-19108436 GTGGGTTCTTAACATGTGCTAGG - Intergenic
1135067866 16:19326019-19326041 GTGGGTACCTACTATGTGCCTGG + Intergenic
1135642428 16:24132564-24132586 TTGGGTCCTTACTATGTGCCAGG + Intronic
1136170052 16:28483648-28483670 TTGAGTACTTACCATGTGCCAGG - Intronic
1138241501 16:55431038-55431060 CTGCCTCCTTACCAGGTGTCAGG + Intronic
1139489001 16:67276588-67276610 ATGGGTCCTTGCCATGTGACTGG + Intergenic
1139993126 16:70955658-70955680 CTGCCTCCTTCCCATGTGGCTGG + Intronic
1141559641 16:84858819-84858841 GTGGCTGCATACCAGGTACCAGG + Intronic
1142269086 16:89079813-89079835 GTGGGGCCTCACCATGTCCCAGG + Intergenic
1143556694 17:7666417-7666439 TTGGTACCTTACCCTGTGCCAGG - Intronic
1144805481 17:17963611-17963633 CTGGCCCCTCACCATGTGCCAGG - Intronic
1144816113 17:18036653-18036675 TTGACTACCTACCATGTGCCAGG + Intronic
1145375616 17:22344886-22344908 TTGTCTCCTTACCATGTGCATGG - Intergenic
1146578397 17:34014132-34014154 TTGGGTACTTACTATGTGCCAGG + Intronic
1147788496 17:42997791-42997813 GCAGCTGCTTACCCTGTGCCAGG - Intergenic
1147857389 17:43492579-43492601 GTGGGTACCTACCATGTGCATGG + Intronic
1148472190 17:47901745-47901767 GTGGATCCTGACCTAGTGCCAGG + Intronic
1149028069 17:52052977-52052999 GTGGCTTCCTACTATGTGCCTGG + Intronic
1149435529 17:56630370-56630392 CTGGATCCCTACCATGTGCCAGG + Intergenic
1149785173 17:59428672-59428694 TTGAATCCTTACCACGTGCCAGG + Intergenic
1149794363 17:59505771-59505793 GCGGCTCCATCCCATGTGTCAGG + Intergenic
1150133467 17:62681489-62681511 GTGCCTACTTACCATGTACTGGG + Intronic
1150435582 17:65151826-65151848 ATGCCTCCTTACCATCTTCCTGG + Intronic
1150661297 17:67082028-67082050 GTGGCTATTTACCATGGGCCAGG + Intronic
1153579350 18:6556468-6556490 TTAGCTACTTACTATGTGCCAGG + Intronic
1155249304 18:23940048-23940070 GTGACTCCAGACCATGTGCCAGG + Intronic
1156504773 18:37582894-37582916 TTGAGTGCTTACCATGTGCCAGG - Intergenic
1158071149 18:53471997-53472019 GTGCATGCCTACCATGTGCCAGG - Intronic
1158414327 18:57236019-57236041 GTGGTTCCTTAACAAGTACCAGG + Intergenic
1158618366 18:59008482-59008504 GTTCCTCCTTTCCATCTGCCTGG - Intergenic
1161567676 19:5012613-5012635 GGGGCGCCCTACCATCTGCCTGG - Intronic
1161609564 19:5234029-5234051 TTAGCTACCTACCATGTGCCAGG + Intronic
1161907530 19:7168219-7168241 GGGTCTCCTCCCCATGTGCCTGG + Intronic
1162850923 19:13430631-13430653 GTGAATACTTACTATGTGCCAGG + Intronic
1163152539 19:15423815-15423837 GTGCTTACTTACCATGTGCCAGG + Intronic
1163392319 19:17038236-17038258 GTGGCTCCTCAGCTTCTGCCCGG - Intergenic
1165289443 19:34871269-34871291 GTGCTTCCTTACCATGAGACTGG + Intergenic
1165908295 19:39207260-39207282 TTGAGTCCTTACTATGTGCCAGG - Intergenic
1167110213 19:47456295-47456317 GTGGGCACCTACCATGTGCCAGG - Intronic
1167110853 19:47460142-47460164 GTGCCTCCTTAGCATTTGCCTGG + Intronic
1167110951 19:47460812-47460834 GTGGATGCTTTCCATGTGCCAGG - Intronic
1167493418 19:49804693-49804715 TTGTGTACTTACCATGTGCCGGG + Intronic
1168459754 19:56544101-56544123 GTAAGTCCTTACTATGTGCCAGG - Intronic
925062459 2:903754-903776 GTCCCTCCTGTCCATGTGCCTGG + Intergenic
925703826 2:6665337-6665359 CTGAATGCTTACCATGTGCCAGG + Intergenic
925846904 2:8042950-8042972 CTGGTTTCTTACAATGTGCCAGG + Intergenic
925929931 2:8698768-8698790 TTGCCTGCTTACCATGTGCCAGG - Intergenic
925962198 2:9028029-9028051 CTGGATGTTTACCATGTGCCGGG + Intergenic
927312555 2:21647673-21647695 GTGTCTCCTTATCATCTTCCAGG - Intergenic
928082175 2:28321186-28321208 TTGAGTTCTTACCATGTGCCTGG + Intronic
928399700 2:30969030-30969052 CTGGCTCCTTCCCCTCTGCCTGG - Intronic
930337514 2:50068650-50068672 CTGAGTGCTTACCATGTGCCAGG - Intronic
931695479 2:64867633-64867655 TTGGCCACTTACTATGTGCCAGG - Intergenic
932351689 2:71037818-71037840 GTTGTTCCTGTCCATGTGCCTGG + Intergenic
932746635 2:74339014-74339036 CTGAATGCTTACCATGTGCCAGG - Intronic
933557324 2:83847408-83847430 TTGATTCCTTACCATGTGCTAGG - Intergenic
933776912 2:85776643-85776665 GTACCTCCTTCCCATGTGCATGG - Intronic
934564955 2:95333690-95333712 ATTGCTGCTTACCATGTGCCAGG - Intronic
934730556 2:96653939-96653961 GCAGCCCCTTCCCATGTGCCAGG + Intergenic
937239765 2:120452427-120452449 CTGGCTCCTTCCCATGTGGCAGG - Intergenic
939213763 2:139211456-139211478 GTGGCTGCATACCAGGTACCAGG - Intergenic
940478269 2:154193954-154193976 TTGGTTGCTTACCATTTGCCAGG - Intronic
941039033 2:160599648-160599670 ATGACTATTTACCATGTGCCAGG - Intergenic
941299089 2:163778475-163778497 CTGGCTACTAACCATGTGCCAGG - Intergenic
941754951 2:169174937-169174959 GTGGCTCTTCACCATGTGCTGGG - Intronic
942045726 2:172098217-172098239 GTGAGTTGTTACCATGTGCCAGG + Intergenic
943056280 2:182984838-182984860 AGGACTCATTACCATGTGCCAGG - Intronic
943723225 2:191227361-191227383 ATTGATGCTTACCATGTGCCAGG + Intergenic
944526450 2:200624564-200624586 GTTGGTCCTCACCATGTGCCTGG - Intronic
944540963 2:200753166-200753188 GTGAGTGCTAACCATGTGCCAGG - Intergenic
944661774 2:201927364-201927386 TTGGGTGTTTACCATGTGCCAGG - Intergenic
945009135 2:205443092-205443114 GTGAATGCTTACTATGTGCCAGG - Intronic
946459428 2:219856016-219856038 GTGAGTGCTTCCCATGTGCCAGG - Intergenic
946677769 2:222180681-222180703 GTGCATTCTTGCCATGTGCCAGG - Intergenic
946861311 2:224002431-224002453 TTGGGTCCTTACAATGTGCCAGG + Intronic
947820770 2:233067949-233067971 GTGGGTGCTTACCACATGCCTGG - Intronic
948281871 2:236753169-236753191 GGGGCTCTTTACCCTGTTCCTGG + Intergenic
948289607 2:236815582-236815604 GTTGATCATCACCATGTGCCAGG - Intergenic
1168861816 20:1051112-1051134 CTGACCACTTACCATGTGCCTGG - Intergenic
1169006117 20:2208254-2208276 GAGGCAGCTTACTATGTGCCTGG - Intergenic
1171299677 20:24049612-24049634 CTGTTTCCTTACCCTGTGCCTGG + Intergenic
1171367269 20:24633805-24633827 GGGGCTCCTAACCAAGAGCCTGG - Intronic
1172016062 20:31873917-31873939 CTAGCTCCTTACCATGGCCCTGG + Intronic
1173215832 20:41082291-41082313 ATAGGTGCTTACCATGTGCCAGG + Intronic
1173693704 20:44988004-44988026 GAGGCTCCCTAACATGTCCCAGG - Intronic
1174125607 20:48302906-48302928 TTGAGTCCTTCCCATGTGCCAGG + Intergenic
1174171452 20:48620334-48620356 GTGGCTCCAGACCCTGAGCCCGG - Intergenic
1175182046 20:57155591-57155613 TTAGCTCCTTACTCTGTGCCAGG - Intergenic
1175412046 20:58776888-58776910 GTGGGTGCCTACCATGTGCCAGG + Intergenic
1177447417 21:21216139-21216161 GTGGCTTTTGACTATGTGCCAGG + Intronic
1178961490 21:37070708-37070730 ATTGGTGCTTACCATGTGCCAGG - Intronic
1179906616 21:44426179-44426201 CTGGCCCCTTTCCAGGTGCCAGG + Intronic
1180105805 21:45617367-45617389 GCGGCTCCTTCCCATGGGTCAGG - Intergenic
1182032077 22:27167315-27167337 TTGAGTTCTTACCATGTGCCAGG - Intergenic
1182062777 22:27409775-27409797 TTGGGTCCTTACCATATGCCCGG - Intergenic
1182154044 22:28052291-28052313 GTGACCCTTTATCATGTGCCAGG + Intronic
1183556391 22:38530604-38530626 TTGATTACTTACCATGTGCCAGG - Intronic
1183746327 22:39694101-39694123 GTGCCTCCTTGCACTGTGCCAGG - Intergenic
1184047232 22:41979020-41979042 GTGGCTTGTTAGCATGTGACTGG + Intronic
1184862215 22:47179004-47179026 GTGCCTCCTTGCCTTCTGCCAGG + Intergenic
1185140772 22:49099983-49100005 GTGGCTCCTCACAACCTGCCTGG - Intergenic
949319045 3:2788167-2788189 TTGGGTACTTACCATGTACCAGG + Intronic
950151872 3:10693788-10693810 TTGGCTTCCTACTATGTGCCAGG - Intronic
950761086 3:15227398-15227420 GTGAATACTAACCATGTGCCAGG - Intronic
951003520 3:17592055-17592077 ATGGCTGCATACCATGTACCAGG - Intronic
951350736 3:21603867-21603889 ATGCCTCCCTACCATGTGCTGGG - Intronic
953014863 3:39064072-39064094 AGGGCTCGTTACCATTTGCCTGG - Intronic
953747308 3:45585108-45585130 GGGGGCCCCTACCATGTGCCAGG + Intronic
954111033 3:48433237-48433259 ATGGCTCACTACCTTGTGCCTGG + Intronic
954511591 3:51130437-51130459 GTGGCTGCATACCAGGTACCAGG + Intronic
955444810 3:58998483-58998505 CTGCGTCCTTACCATGTGCCAGG + Intronic
955743520 3:62117980-62118002 GTGAATTCTTGCCATGTGCCTGG + Intronic
956285280 3:67602209-67602231 TTGGGCCTTTACCATGTGCCTGG - Intronic
957009905 3:74992088-74992110 TTTACCCCTTACCATGTGCCAGG - Intergenic
959644944 3:108688707-108688729 CTGGCTCCTTCCCATGTGGCAGG - Exonic
959977384 3:112476081-112476103 GTGAGCCCCTACCATGTGCCAGG + Intronic
961539910 3:127592222-127592244 CTGCCACCCTACCATGTGCCAGG + Intronic
961763778 3:129192010-129192032 TTGGGTGCTTACCATGTGTCAGG - Intergenic
962032349 3:131614481-131614503 GTGTCTCTTTAACTTGTGCCAGG + Intronic
962958574 3:140289106-140289128 GTGACTGCTTACTGTGTGCCAGG + Intronic
966044426 3:175531703-175531725 GTGGCTGCATACCAGGTACCAGG + Intronic
966445586 3:179997774-179997796 GTGGCTGCATACCAGGTACCAGG - Intronic
969039457 4:4283984-4284006 TTGTGTCCTTACCACGTGCCAGG + Intronic
969175172 4:5393268-5393290 ATCGCACCTTTCCATGTGCCTGG + Intronic
969574455 4:8028819-8028841 TTGACTCCTTGCAATGTGCCTGG - Intronic
969625329 4:8302009-8302031 GTGAGTACTAACCATGTGCCAGG - Intronic
970407452 4:15777704-15777726 CTGGGTGATTACCATGTGCCAGG + Intergenic
971150960 4:24031111-24031133 TTGGCTCTTTACTATGTCCCTGG + Intergenic
971239223 4:24872720-24872742 GTGGGTGCTTACCATTTGGCGGG - Intronic
971273223 4:25171021-25171043 GTGAATGCTTACTATGTGCCAGG - Intronic
972869915 4:43285065-43285087 GTGAGTACTTACTATGTGCCAGG + Intergenic
972920261 4:43930842-43930864 GTAGCTGCTTACTATATGCCAGG - Intergenic
973121118 4:46522014-46522036 ATGGCTGCATACCAGGTGCCAGG + Intergenic
973130289 4:46640463-46640485 GTGGCTGCATACCAGGTTCCAGG + Intergenic
974881612 4:67765369-67765391 CTGATTCCTTACTATGTGCCAGG - Intergenic
977688443 4:99876025-99876047 GTAGCTGCATACCAGGTGCCAGG - Intergenic
978611355 4:110544532-110544554 TTGGCGACTTACTATGTGCCAGG + Intronic
978673472 4:111280042-111280064 TTGAGTGCTTACCATGTGCCAGG - Intergenic
978772257 4:112468571-112468593 GTGGCTGCATACCAGGTACCAGG + Intergenic
978899179 4:113927616-113927638 GTGGCTGCATACCAGGTACCAGG + Intronic
978972242 4:114822714-114822736 GTGGCTACCTACTATGTGCCAGG + Intergenic
979601806 4:122593641-122593663 CTGAATCCTTACTATGTGCCAGG - Intergenic
980602058 4:135038696-135038718 GTGGCTGCATACCAGGTACCAGG - Intergenic
981134503 4:141194966-141194988 TTGTATCCTTACCATGTGCCAGG - Intronic
983227069 4:165095299-165095321 GGGGCTGCATAGCATGTGCCTGG - Intronic
983411743 4:167407899-167407921 GTGGCTGCATACCATATACCTGG - Intergenic
983573623 4:169236657-169236679 GTGGGTTCTTACTGTGTGCCAGG - Intronic
983913409 4:173265523-173265545 CTTGCTGCTTACCATGTGCTAGG - Intronic
984947474 4:184981229-184981251 GTTGCTCCCTTCCATGTGCCAGG - Intergenic
985495066 5:199615-199637 GTGGCTGCTCCCCATGGGCCAGG - Exonic
989541100 5:42619594-42619616 GTGAGTACTTACAATGTGCCAGG - Intronic
994349511 5:98728366-98728388 GTGGCCACTTACTGTGTGCCAGG - Intergenic
995730988 5:115241731-115241753 CTGAATGCTTACCATGTGCCAGG + Intronic
996259209 5:121445534-121445556 GTGGATGATTACCATGTGGCTGG - Intergenic
996825459 5:127677051-127677073 GTGGCTGCATACCAGGTACCAGG - Intergenic
996898332 5:128513075-128513097 GTGGAAGCTTACCATGTGTCAGG + Intronic
998806556 5:145922535-145922557 GTGAGTTCTTACTATGTGCCTGG - Intergenic
1000268989 5:159664979-159665001 CTGATTACTTACCATGTGCCAGG - Intergenic
1001050239 5:168408327-168408349 GTGGGTCCTTGCTGTGTGCCAGG - Intronic
1001140325 5:169138618-169138640 GTGGGAACTTAACATGTGCCAGG - Intronic
1001332794 5:170773915-170773937 GTGTCCCCCTACCGTGTGCCAGG + Intronic
1001352420 5:170981604-170981626 GCTGCTCCTTGCCTTGTGCCAGG + Intronic
1001752210 5:174140291-174140313 GTGGATACCTACTATGTGCCAGG - Intronic
1002061561 5:176628794-176628816 GTGTCCACTTACTATGTGCCAGG - Intronic
1002767494 6:254976-254998 TTGGGTTCCTACCATGTGCCAGG + Intergenic
1003303191 6:4903374-4903396 GTGGCCGCCTACCATGTGGCAGG - Intronic
1003620514 6:7695156-7695178 GTAGCTCCATACCAAGTGCTAGG + Intergenic
1003908047 6:10720374-10720396 GTGCCTCCTTAGCATCGGCCAGG - Intergenic
1004603833 6:17175618-17175640 TTGGTTGCTCACCATGTGCCAGG + Intergenic
1005888557 6:30117098-30117120 TTGAATGCTTACCATGTGCCAGG + Intergenic
1006909567 6:37555251-37555273 GTGGCCCTTTATCATCTGCCGGG + Intergenic
1008905975 6:56678162-56678184 GTGGCACCTGGCCGTGTGCCTGG + Intronic
1009422771 6:63482284-63482306 TTGGCTGCCTACCATGTGCCAGG - Intergenic
1009695028 6:67091525-67091547 TTGACTCCCTACCAAGTGCCAGG + Intergenic
1010325431 6:74557373-74557395 GTGGATGCATACCAGGTGCCAGG + Intergenic
1010766623 6:79782572-79782594 CTGGGTACTTAGCATGTGCCAGG - Intergenic
1010938346 6:81887199-81887221 ATGGCTACATACCAAGTGCCAGG + Intergenic
1011377729 6:86707686-86707708 GTGGCTACTTACCATCTGGCAGG + Intergenic
1011388203 6:86820695-86820717 GTTGCTGCTTGCCATGTACCTGG + Intergenic
1012938739 6:105395527-105395549 TTGGATGGTTACCATGTGCCAGG - Intronic
1014539623 6:122658870-122658892 GTACCTACTTACCATCTGCCAGG + Intronic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1015513720 6:134064275-134064297 TTGGATGCTTACCATGTGCCTGG + Intergenic
1016995867 6:149962237-149962259 CTGGGTCCTTAGCATGTGCAAGG + Intergenic
1017002712 6:150006931-150006953 CTGGGTCCTTAGCATGTGCAAGG - Intergenic
1017012314 6:150070921-150070943 CTGGGTCCTTAGCATGTGCAAGG - Intergenic
1017044178 6:150331622-150331644 GTAGCTGCATACCATGTACCAGG + Intergenic
1018127112 6:160692303-160692325 GTGGCTCCATACCACATGGCTGG + Intergenic
1018149449 6:160924776-160924798 GTGGCTCCATACCATATGGCTGG - Intergenic
1018599779 6:165526742-165526764 GTGGCTGCATACCAGGTACCAGG - Intronic
1020594917 7:10194737-10194759 ATGTCTGCTTACTATGTGCCAGG - Intergenic
1022351943 7:29574546-29574568 GTGGCTCCTTGGCAGGTCCCTGG + Intergenic
1022954579 7:35369472-35369494 GTGAATGCTTACAATGTGCCAGG + Intergenic
1023041760 7:36178769-36178791 AGGGCTCCTGACCTTGTGCCAGG - Intronic
1023685861 7:42734756-42734778 CTGGGTCCTTACTATCTGCCAGG + Intergenic
1025298347 7:57794902-57794924 TTGTCTCCTTACCGTGTGCATGG - Intergenic
1026428936 7:70324793-70324815 ATGGCACCTTGCCATGTGGCGGG + Intronic
1026929846 7:74217728-74217750 GTGGCCACTGCCCATGTGCCTGG - Intronic
1028237720 7:88382049-88382071 GTGGCTGCATACCAGGTACCAGG - Intergenic
1028525028 7:91774656-91774678 GTGGGTCCTCACCATGTCCAAGG - Intronic
1030271971 7:107678251-107678273 TTGAATACTTACCATGTGCCAGG + Intronic
1030876201 7:114816537-114816559 GTGGATCATTTCTATGTGCCAGG - Intergenic
1031138125 7:117908544-117908566 GTGAGGACTTACCATGTGCCAGG + Intergenic
1031985876 7:128164458-128164480 GTGCCTCCTCACAATGAGCCTGG + Intergenic
1032061603 7:128729805-128729827 GGGGGTGCTTACGATGTGCCAGG - Intronic
1032668866 7:134065487-134065509 GTGGGCACTTACCATGTTCCTGG + Exonic
1032741146 7:134740878-134740900 TTGGATTCTTACCATGTGCAAGG + Intergenic
1034467975 7:151240928-151240950 TTGGGCACTTACCATGTGCCAGG - Intronic
1036020946 8:4845590-4845612 TTGGGTTCCTACCATGTGCCAGG + Intronic
1038272498 8:26086957-26086979 TTGGCACTCTACCATGTGCCAGG + Intergenic
1038584148 8:28774613-28774635 GTGACTCATTTCCATGAGCCTGG - Intronic
1039324273 8:36467308-36467330 GTGGCTGCATACCAGGTACCAGG + Intergenic
1040531210 8:48267985-48268007 TTTGCTCCTTGCCATTTGCCCGG + Intergenic
1040873768 8:52128696-52128718 ATGGGTCCTCACCATGGGCCAGG - Intronic
1041934450 8:63320545-63320567 ATGGCTGCATACCAGGTGCCAGG - Intergenic
1043257904 8:78158585-78158607 GTGGCTGCATACCAGGTACCAGG - Intergenic
1045221721 8:100206237-100206259 GTGGCTGCATACCAGGTACCAGG - Intronic
1045312246 8:101013344-101013366 GTGAACCCTTACTATGTGCCTGG - Intergenic
1046699031 8:117378788-117378810 TTGACTGATTACCATGTGCCAGG - Intergenic
1047348373 8:124050087-124050109 GTGGGCACTTACCATGTGTCCGG + Intronic
1047951997 8:129942721-129942743 GTGAGTCCTTACAATGTGCCAGG + Intronic
1049490737 8:142900079-142900101 GTAGCTACATACCATGTACCAGG - Intronic
1051118024 9:13719658-13719680 GTGCAAACTTACCATGTGCCAGG + Intergenic
1051265969 9:15308378-15308400 TTGAGTCCTTACTATGTGCCAGG + Intergenic
1053128311 9:35600342-35600364 GAAGCTGCTTGCCATGTGCCTGG + Intergenic
1053392469 9:37745717-37745739 GAGGCACCTAACCATGTGACAGG + Exonic
1053795248 9:41721116-41721138 TTGTCTCCTTACCATGTGCATGG + Intergenic
1054149922 9:61593730-61593752 TTGTCTCCTTACCATGTGCATGG - Intergenic
1054183660 9:61933183-61933205 TTGTCTCCTTACCATGTGCATGG + Intergenic
1054469689 9:65524833-65524855 TTGTCTCCTTACCATGTGCATGG - Intergenic
1054654847 9:67655304-67655326 TTGTCTCCTTACCATGTGCATGG - Intergenic
1054724937 9:68640847-68640869 CTGCCTCCTTACTCTGTGCCAGG + Intergenic
1055734063 9:79309112-79309134 GTGAGTACTTACTATGTGCCAGG - Intergenic
1059441286 9:114308500-114308522 TTGGGTCCCTATCATGTGCCAGG + Intronic
1059463403 9:114449841-114449863 TTGGTTGCTTATCATGTGCCAGG + Intronic
1060521620 9:124297309-124297331 GAGGTCCCTTCCCATGTGCCAGG + Intronic
1060672910 9:125486119-125486141 ATGAGTGCTTACCATGTGCCAGG + Intronic
1061382045 9:130264690-130264712 GTGCCTCCCCACCATGTGCTTGG + Intergenic
1061423093 9:130482774-130482796 GTGGCTCCTTACCACCCACCTGG + Intronic
1061425960 9:130498600-130498622 GTGGGTGCTCACCATGTGCCAGG + Intronic
1061451936 9:130672143-130672165 GTGGCCACTTACTATGTGCTAGG - Intronic
1062197107 9:135280411-135280433 GAGGCTCTGTACCATGTGGCTGG + Intergenic
1062197120 9:135280470-135280492 GAGGCTCTGTACCATGTGGCTGG + Intergenic
1062588055 9:137259344-137259366 GTGGTTCCTGACCATGTGCGTGG + Intronic
1186943567 X:14540026-14540048 GTGACTAGTCACCATGTGCCAGG + Intronic
1190421536 X:50289585-50289607 CTGGGTGCTTACCATGTGTCAGG + Intronic
1190455743 X:50626321-50626343 CTGCCCCCTTACCAGGTGCCAGG + Intronic
1192655474 X:72988874-72988896 CTAGATCCCTACCATGTGCCAGG + Intergenic
1192910248 X:75596480-75596502 CTGACTGCTTACCATGTGCTAGG + Intergenic
1193659404 X:84238575-84238597 TTGACTGCCTACCATGTGCCAGG - Intergenic
1195993433 X:110706998-110707020 GTCTCTCCTTACCATGAGCTGGG + Intronic
1196111628 X:111952764-111952786 GTGACTGCTTACTGTGTGCCAGG + Intronic
1196138027 X:112230650-112230672 GTGGCTCCACTCCATGTGCAAGG + Intergenic
1196388678 X:115187672-115187694 GTAAGTGCTTACCATGTGCCAGG - Intronic
1197097364 X:122612052-122612074 GTGGCTGCATACCAGGTACCAGG - Intergenic
1197204881 X:123781245-123781267 TTTGTTCCTTACCAAGTGCCTGG - Intergenic
1197657905 X:129137469-129137491 GTTGCTTTATACCATGTGCCAGG - Intergenic
1200125594 X:153812738-153812760 GTGGCTCCTTACCATGTGCCTGG - Intronic
1200210757 X:154345711-154345733 GTGCCCCCTCACCCTGTGCCTGG - Intergenic
1200220095 X:154386381-154386403 GTGCCCCCTCACCCTGTGCCTGG + Intergenic