ID: 1200125659

View in Genome Browser
Species Human (GRCh38)
Location X:153813041-153813063
Sequence CAATTGGAATTGCTTGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200125659_1200125664 -6 Left 1200125659 X:153813041-153813063 CCCTGGCCAAGCAATTCCAATTG 0: 1
1: 0
2: 1
3: 19
4: 153
Right 1200125664 X:153813058-153813080 CAATTGGATCAAAGACCTACAGG 0: 1
1: 0
2: 0
3: 18
4: 133
1200125659_1200125667 28 Left 1200125659 X:153813041-153813063 CCCTGGCCAAGCAATTCCAATTG 0: 1
1: 0
2: 1
3: 19
4: 153
Right 1200125667 X:153813092-153813114 ACAAGAGAACAATATCTTTATGG 0: 1
1: 0
2: 0
3: 25
4: 330
1200125659_1200125665 -5 Left 1200125659 X:153813041-153813063 CCCTGGCCAAGCAATTCCAATTG 0: 1
1: 0
2: 1
3: 19
4: 153
Right 1200125665 X:153813059-153813081 AATTGGATCAAAGACCTACAGGG 0: 1
1: 2
2: 10
3: 58
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200125659 Original CRISPR CAATTGGAATTGCTTGGCCA GGG (reversed) Intronic
902584125 1:17427662-17427684 CACTTGAACTTGCTTGGCCAAGG + Intronic
907536497 1:55165113-55165135 CAATAGGAATTGATTAGTCATGG + Intronic
913320107 1:117582162-117582184 CACTTGGAGTTGCTTGGCCTTGG - Intergenic
915434750 1:155895845-155895867 GAATTGGAATTGCTTGAACCCGG - Intergenic
915886565 1:159728524-159728546 GAATTGGAGTAGCTTGGCCATGG - Intergenic
918898363 1:190378890-190378912 CAGTAGGACTTGCTTGGCAAGGG + Intronic
919348544 1:196418547-196418569 CAACTGGAATTTCTAGGACAAGG + Intronic
919775622 1:201192319-201192341 AAAATGGAACCGCTTGGCCATGG + Intronic
924484216 1:244464541-244464563 CAAATAGAGTTGCCTGGCCATGG + Intronic
1065112088 10:22450148-22450170 CACCTGGAATTGCTGGGCCTTGG - Intronic
1071417060 10:85451205-85451227 CAAGTGGAATTCCTTGCCCTTGG + Intergenic
1071941584 10:90597064-90597086 CAATTGGAAATGGCTGGCTAGGG - Intergenic
1072237843 10:93468607-93468629 CAACTGGAAATTCTTGGCCTGGG - Intronic
1072986934 10:100149125-100149147 CACTTTGAACTGCTTGGCCTGGG - Intergenic
1075797160 10:125128770-125128792 GAAATGGAATTGCTGGGTCATGG - Intronic
1077933653 11:6759916-6759938 CAAGTAGAATTGCTTGGTTATGG + Intergenic
1078955600 11:16191019-16191041 CAATTGTAGTTCCTTTGCCATGG - Intronic
1079394162 11:20047536-20047558 TAATTGGAAGTGCTTGGCAATGG + Intronic
1080450049 11:32371550-32371572 AATATAGAATTGCTTGGCCATGG + Intergenic
1085585426 11:77699730-77699752 GAATTGGAATTGCTGGGTCAAGG - Intronic
1088087165 11:105995154-105995176 TAAATGGACTTTCTTGGCCAGGG - Intergenic
1090972442 11:131654987-131655009 CAATCGGAAATGCTGGGCCTGGG + Intronic
1091197856 11:133747222-133747244 CACTTGGAATTACAGGGCCAAGG - Intergenic
1097610243 12:61810808-61810830 CAGTTGGAAGTACTTGCCCAAGG + Intronic
1099176132 12:79424516-79424538 CAATTTGAAATGCATGGCCATGG + Intronic
1100023405 12:90098642-90098664 TGACTGGAATTGCTTGGTCAGGG + Intergenic
1108742374 13:53351333-53351355 CACTTGTAATTTCTTGGCTAAGG - Intergenic
1109152284 13:58859965-58859987 CAGGTTGAATTCCTTGGCCAGGG + Intergenic
1111488978 13:88944239-88944261 CAATTGCAATTTATTGGCAAGGG + Intergenic
1113384745 13:109838543-109838565 CAATTAGAATGGCTTCTCCATGG - Intergenic
1115170411 14:30498543-30498565 CAATGGGAATTTCTTTGGCATGG - Intergenic
1115510040 14:34129902-34129924 CAATTGTAATGGCTAGGCTAGGG - Intronic
1115516758 14:34192966-34192988 CAATTCCAATTGCTTAGCAATGG + Intronic
1116012991 14:39372878-39372900 CAGTAGGAATTGCTTGTCTATGG - Intronic
1116438155 14:44918395-44918417 GAAGTGGAATTGCTGGGCCAGGG - Intergenic
1120304883 14:82756970-82756992 CATTTTGAATTGCTTTTCCATGG + Intergenic
1120553739 14:85903927-85903949 GTATTGGAAGTTCTTGGCCAGGG - Intergenic
1120744831 14:88143763-88143785 CAGGTTGAATTTCTTGGCCAGGG - Intergenic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1127371999 15:58350139-58350161 AAAATGGAATTGCTTGGAAATGG + Intronic
1127823156 15:62678087-62678109 AAGTTGCAAGTGCTTGGCCAGGG - Intronic
1128719685 15:69939147-69939169 CATGTGTAATTGCTTCGCCATGG - Intergenic
1130926579 15:88389997-88390019 GAATTGCAGTTGCTTGGGCATGG - Intergenic
1130983888 15:88832048-88832070 CAATTGGAGCTGCTCAGCCAAGG + Intronic
1135822503 16:25696470-25696492 CAATGGGAAGTGATTGTCCATGG + Intronic
1136104911 16:28023468-28023490 CAGTTGAAATTGCTGGGGCAAGG + Intronic
1136712150 16:32247918-32247940 TAATTGTAATTGGTTGGGCATGG + Intergenic
1136755765 16:32681486-32681508 TAATTGTAATTGGTTGGGCATGG - Intergenic
1136812348 16:33188886-33188908 TAATTGTAATTGGTTGGGCATGG + Intergenic
1136818824 16:33298966-33298988 TAATTGTAATTGGTTGGGCATGG + Intronic
1136825387 16:33355499-33355521 TAATTGTAATTGGTTGGGCATGG + Intergenic
1136830453 16:33454270-33454292 TAATTGTAATTGGTTGGGCATGG + Intergenic
1137307145 16:47213588-47213610 CAATTAGAATTGCTATGTCACGG + Intronic
1138410571 16:56836481-56836503 CAAGTGGAATTGCTTGCCCTGGG - Intronic
1202990925 16_KI270728v1_random:11856-11878 TAATTGTAATTGGTTGGGCATGG + Intergenic
1203057906 16_KI270728v1_random:941842-941864 TAATTGTAATTGGTTGGGCATGG - Intergenic
1143098598 17:4492059-4492081 CAACTGGAATCTCTTGCCCAGGG - Intergenic
1144126074 17:12204140-12204162 CAAATGAAACTGCTTTGCCAAGG + Intergenic
1144439177 17:15266041-15266063 CAATTGGAAATTCTTGGAGAGGG + Intergenic
1144619244 17:16805933-16805955 CAAAGGGAACTGCTTGGGCATGG + Intergenic
1144893451 17:18509762-18509784 CAAAGGGAACTGCTTGGGCATGG - Intergenic
1145138774 17:20434512-20434534 CAAAGGGAACTGCTTGGGCATGG + Intergenic
1147055937 17:37835211-37835233 CAAAGGGAACTGCTTGGGCATGG - Intergenic
1149033658 17:52110820-52110842 CCATGGGAGCTGCTTGGCCATGG - Intronic
1149637387 17:58181859-58181881 CCATTGGAATTCCTGGTCCATGG - Intergenic
1155869891 18:31013868-31013890 GAAATGGAATTGCTTAGTCAAGG - Intronic
1156220394 18:35045015-35045037 CAATTGGAATTACTAATCCAGGG - Intronic
1158243432 18:55403879-55403901 CAATGGGAATTACTAGGCTAGGG - Intronic
1160739444 19:679247-679269 CATCTGGAAATGCTCGGCCAGGG - Intronic
1162137855 19:8567153-8567175 GAATTGGAATTGCTTGAACCTGG - Intronic
1163911664 19:20199983-20200005 GAATTGGAATTGCTTGAACCTGG + Exonic
1164699760 19:30276314-30276336 AACTTGGAATTTCTTGGCAAGGG + Intronic
1165000443 19:32757534-32757556 GAATTGGAATTGCTGGGTGAGGG + Intronic
1166247221 19:41537781-41537803 CAGGTTGAATTCCTTGGCCATGG - Intergenic
927873230 2:26637661-26637683 CAAGTGGAATGGCTGGGTCAAGG + Intronic
928025426 2:27735553-27735575 CGATGGGAAGTGCTTGCCCACGG - Intergenic
929961196 2:46497631-46497653 CAAGGGGCATAGCTTGGCCAGGG - Intronic
933125170 2:78595670-78595692 CATTTGGTACTGCTTTGCCAAGG - Intergenic
935185038 2:100724152-100724174 CTATTGGAGTGGCTTGGGCAGGG - Intergenic
940032143 2:149274783-149274805 AAATTGGAAATGCTTGTTCAAGG + Intergenic
941849900 2:170169709-170169731 TCATTAGAATTGCTTAGCCAGGG + Intergenic
942099917 2:172570059-172570081 CAATCGCAATTGCTGTGCCAGGG + Intronic
948539657 2:238680732-238680754 GAAGTGGAATTGCTGGGTCAAGG + Intergenic
948692956 2:239718513-239718535 TAATTAGAAGTGCTTGGGCAGGG + Intergenic
1169069411 20:2713869-2713891 GAATTGGTAATGCGTGGCCAGGG + Intronic
1169686590 20:8280796-8280818 AGATTGAAACTGCTTGGCCAAGG + Intronic
1170152182 20:13237215-13237237 CAGGTGGAATTGCTGGGCCAAGG - Intronic
1172980279 20:38936372-38936394 CAGATGGAATGGCTTGTCCAGGG + Intronic
1174479949 20:50824271-50824293 CAAATGCAACTGCTGGGCCAAGG - Intronic
1174828653 20:53792633-53792655 GAAATGGAATTGCTAGGTCAGGG + Intergenic
1175737388 20:61396624-61396646 CAAGTGGAGTTGCCAGGCCAAGG - Intronic
1178745190 21:35242556-35242578 CAAGTGGAATTGCTGGGCCAAGG - Intronic
1179917460 21:44486616-44486638 CAGGTTGAATTCCTTGGCCAGGG - Intergenic
1184534760 22:45078680-45078702 CGAGTGGAATTGCTGGGTCATGG - Intergenic
949337861 3:2995849-2995871 AAAATGGAATTGCTGGGCCATGG - Intronic
949505989 3:4728149-4728171 GAAGAGGAATTCCTTGGCCAAGG + Intronic
950512576 3:13440289-13440311 AAGTTGGGATTGCTTGGTCAAGG - Intergenic
952015146 3:28947946-28947968 CAATTTGAATTGCTTGGCTTGGG - Intergenic
952984329 3:38764048-38764070 CATTTGGAATTGTATGGCCTGGG - Intronic
956944364 3:74202646-74202668 AAAGTGGAATTGCTGGGTCATGG - Intergenic
959486159 3:106929056-106929078 CCATTGAAATTGCTTTGTCAAGG - Intergenic
962024784 3:131536389-131536411 CCATTGAAATTGCTTGCCCAGGG - Intronic
962674823 3:137747600-137747622 ACCTTGGAATGGCTTGGCCAAGG - Intergenic
962748752 3:138417429-138417451 GAATTGGAATAACTTGCCCAAGG - Intergenic
963334769 3:143962179-143962201 GAAGTGGAATTGCTGAGCCATGG + Intergenic
963457100 3:145557707-145557729 CAATTGTAATCCCTTGGGCATGG - Intergenic
963887169 3:150595808-150595830 GAAGTGGAATTGCTGGGTCAAGG + Intronic
964438677 3:156680390-156680412 CAATTAGAATTGCTAGCTCATGG - Intronic
965807362 3:172555946-172555968 GCAGTGGAATTGCTGGGCCAAGG - Intergenic
966697263 3:182803112-182803134 GAAGTGGAATTGCTGGGTCATGG + Intronic
971722818 4:30268424-30268446 GAATTGGAATTGCTGGGTCATGG - Intergenic
972667712 4:41183205-41183227 CAATGGTGATTGCTGGGCCAGGG - Intronic
972844755 4:42974213-42974235 AAATTGGGATTGATTGGTCAGGG + Intronic
973851235 4:54963534-54963556 CCTTTGGAATTACCTGGCCAGGG - Intergenic
976206590 4:82628341-82628363 CTATTGGAATTGCTTTCCCTGGG + Intergenic
979987674 4:127335179-127335201 CAATTGGAACTGCCTAGCCCAGG + Intergenic
981197090 4:141934247-141934269 CCATATGACTTGCTTGGCCAAGG - Intergenic
982508367 4:156249280-156249302 GAAGTGGAATTGCTGGGTCAGGG + Intergenic
985005731 4:185533999-185534021 TAATAGGAATTGCTTGGCCCAGG + Intronic
986208149 5:5645605-5645627 CAATAGCAATTGCCTGGGCAGGG - Intergenic
987269797 5:16294927-16294949 CAATTGGCATAGGGTGGCCAAGG - Intergenic
989091476 5:37738098-37738120 CAAGTGGAATTTTTTGGTCAAGG + Intronic
991275365 5:64840837-64840859 CATTGGGAATGGCTAGGCCAGGG + Intronic
993023938 5:82625010-82625032 CAATTGAAGTTTCTTGGTCATGG - Intergenic
994445259 5:99864184-99864206 GAAGTGGAATTGCTAGGCCATGG + Intergenic
996423415 5:123286773-123286795 GAAGTGGAATTGCTGGGCCACGG + Intergenic
1000986605 5:167867510-167867532 CAATTGGGATAGTTTTGCCAGGG + Intronic
1001784500 5:174400581-174400603 GAATTGGAATTGCTTGCACTGGG + Intergenic
1003954010 6:11145544-11145566 GAAGTGCAATTTCTTGGCCATGG + Intergenic
1004000342 6:11591798-11591820 TTATTTGAATTCCTTGGCCAGGG - Intergenic
1004295446 6:14405970-14405992 TACTTTGGATTGCTTGGCCAGGG + Intergenic
1006191513 6:32212578-32212600 CAGTGGGAATTGCGTGGGCAGGG + Exonic
1006713697 6:36099138-36099160 GAAGTAAAATTGCTTGGCCATGG + Intronic
1009725621 6:67532747-67532769 CAGGTTGAATTCCTTGGCCAGGG + Intergenic
1011651949 6:89514727-89514749 GAATTGGAATTGTTTGGGCATGG + Intronic
1013036586 6:106390940-106390962 GAATTTGAATTGCTGGGACATGG + Intergenic
1013350488 6:109301479-109301501 CCCCTGGAATTGCTTTGCCAGGG + Intergenic
1018271244 6:162080242-162080264 GAATTGAAATTACTTGCCCAAGG - Intronic
1024083497 7:45874876-45874898 CAAGTGGAATTGCTGGTTCAAGG - Intergenic
1024975739 7:55112285-55112307 GAATTTGAAATGCTTGGGCAGGG - Intronic
1028547126 7:92014533-92014555 GCATTGGAATTGCTTGGGCATGG + Intronic
1028829648 7:95313386-95313408 CATTTGCAGTTGCTTTGCCAAGG - Intronic
1029023915 7:97394304-97394326 GAAGTGGAACTGCTTGGACAAGG + Intergenic
1029555778 7:101268008-101268030 CAAGTGGAATTTCCTGGGCAAGG + Intergenic
1031450887 7:121916529-121916551 CAATTACAAATTCTTGGCCAGGG - Intronic
1034097349 7:148422055-148422077 CAATTGCTATTGATTGGCCTTGG - Intergenic
1035088147 7:156279066-156279088 CCAGTGGCATTGTTTGGCCAAGG - Intergenic
1038932589 8:32211427-32211449 AAAGTGGAATTGCTGAGCCAGGG + Intronic
1042568939 8:70141548-70141570 CAATTGTTATTTCTTAGCCAAGG - Intronic
1043885337 8:85593077-85593099 AAATTGGCATTGCTTAGCAAAGG + Intergenic
1043927019 8:86048745-86048767 AAGTGGGAAATGCTTGGCCAAGG + Exonic
1045734719 8:105281299-105281321 CCATTGGACTTGCTGGGTCAGGG - Intronic
1046375512 8:113374920-113374942 CAATGATAAGTGCTTGGCCACGG - Intronic
1047401188 8:124548935-124548957 CCTTTGGAAGTGTTTGGCCAAGG + Intronic
1051152790 9:14102421-14102443 CATTGGGAATTACTTGGCAAAGG - Intronic
1052270072 9:26618853-26618875 GAATTGAAATTACTTGGACAGGG - Intergenic
1054799579 9:69334062-69334084 CAAGTGAAATGACTTGGCCAAGG + Intronic
1056684396 9:88747469-88747491 CAATAGGAAATGAGTGGCCACGG - Intergenic
1057364215 9:94403687-94403709 AAAGTGGAATTGCTGGGTCATGG + Intronic
1057659121 9:96984384-96984406 AAAGTGGAATTGCTGGGTCATGG - Intronic
1057990303 9:99761996-99762018 CATTTGTAATTGCTAGGCAAGGG - Intergenic
1059546898 9:115185165-115185187 TAAGTGGAATTGCTGGGTCATGG + Intronic
1060838878 9:126778798-126778820 GAAGTGGAATTGCCTGGGCATGG + Intergenic
1061371082 9:130198012-130198034 CAGTTAGAATTGCTGGGCCCTGG + Intronic
1185820771 X:3201764-3201786 CTTTGGGAATTGCCTGGCCAAGG - Intergenic
1187137769 X:16564862-16564884 GCAGTGGAATTGCTGGGCCATGG - Intergenic
1191754364 X:64578190-64578212 CAAGTGGAATTGCTGGGTCAAGG + Intergenic
1192197558 X:69038640-69038662 CAAATGGAATTGCTGGTTCATGG + Intergenic
1193752947 X:85369749-85369771 GAATTGGGATTGCTGGGGCATGG + Intronic
1194726069 X:97398833-97398855 GAATTGGAATTGCTTGAACCCGG - Intronic
1195308957 X:103611390-103611412 CAAGTGAAATTACTTGCCCAAGG - Intronic
1195959790 X:110374302-110374324 AAAATGGAATTTCTGGGCCAGGG + Intronic
1198206864 X:134474288-134474310 CAAGTGGAATTTCTGGGTCAAGG + Intronic
1200125659 X:153813041-153813063 CAATTGGAATTGCTTGGCCAGGG - Intronic