ID: 1200128209

View in Genome Browser
Species Human (GRCh38)
Location X:153828118-153828140
Sequence GTTTAAGGAGGCCGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200128199_1200128209 2 Left 1200128199 X:153828093-153828115 CCCCTAAAGATGGGGGAGCACCC No data
Right 1200128209 X:153828118-153828140 GTTTAAGGAGGCCGGGAGGCAGG No data
1200128198_1200128209 3 Left 1200128198 X:153828092-153828114 CCCCCTAAAGATGGGGGAGCACC No data
Right 1200128209 X:153828118-153828140 GTTTAAGGAGGCCGGGAGGCAGG No data
1200128200_1200128209 1 Left 1200128200 X:153828094-153828116 CCCTAAAGATGGGGGAGCACCCG No data
Right 1200128209 X:153828118-153828140 GTTTAAGGAGGCCGGGAGGCAGG No data
1200128201_1200128209 0 Left 1200128201 X:153828095-153828117 CCTAAAGATGGGGGAGCACCCGT No data
Right 1200128209 X:153828118-153828140 GTTTAAGGAGGCCGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200128209 Original CRISPR GTTTAAGGAGGCCGGGAGGC AGG Intronic