ID: 1200128382

View in Genome Browser
Species Human (GRCh38)
Location X:153828895-153828917
Sequence TGCCAGCCCCCTAGCGGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200128382_1200128389 6 Left 1200128382 X:153828895-153828917 CCTATCCCGCTAGGGGGCTGGCA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1200128389 X:153828924-153828946 ACACAAGGTTTCCAAACAGCGGG 0: 1
1: 0
2: 0
3: 18
4: 250
1200128382_1200128392 25 Left 1200128382 X:153828895-153828917 CCTATCCCGCTAGGGGGCTGGCA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1200128392 X:153828943-153828965 CGGGAACAAGAGACGAGGAGTGG 0: 1
1: 0
2: 0
3: 17
4: 171
1200128382_1200128386 -9 Left 1200128382 X:153828895-153828917 CCTATCCCGCTAGGGGGCTGGCA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1200128386 X:153828909-153828931 GGGCTGGCAATGGCCACACAAGG 0: 1
1: 0
2: 2
3: 23
4: 282
1200128382_1200128388 5 Left 1200128382 X:153828895-153828917 CCTATCCCGCTAGGGGGCTGGCA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1200128388 X:153828923-153828945 CACACAAGGTTTCCAAACAGCGG 0: 1
1: 0
2: 1
3: 19
4: 260
1200128382_1200128391 20 Left 1200128382 X:153828895-153828917 CCTATCCCGCTAGGGGGCTGGCA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1200128391 X:153828938-153828960 AACAGCGGGAACAAGAGACGAGG 0: 1
1: 0
2: 1
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200128382 Original CRISPR TGCCAGCCCCCTAGCGGGAT AGG (reversed) Intronic
900472473 1:2861612-2861634 TGCCAGCTCCCTTGAGGGACGGG - Intergenic
900990699 1:6096935-6096957 TGACATCCCCCTAGAGGCATGGG - Intronic
905168914 1:36098700-36098722 TGCCAGGCCCCAAGGGGGACAGG - Exonic
909639921 1:77861603-77861625 TGGCAGGCCCCTAGCAGGACAGG + Intronic
1067350723 10:45473385-45473407 TGCCAGCCCCCTAGCCAGCCTGG - Intronic
1070797125 10:79223338-79223360 TGCCAGCCGCCTGGCAGGCTGGG + Intronic
1070841044 10:79488132-79488154 TGCCAGCCATCTAACTGGATGGG + Intergenic
1073440403 10:103549290-103549312 TGCCAGCCGCCCAGGAGGATGGG - Intronic
1095958174 12:47818555-47818577 TGCCAGCCCTATAGCTGAATAGG + Intronic
1103527502 12:121578339-121578361 TGGCAGGCCCCAAGCGGGAACGG + Intronic
1104859797 12:131918071-131918093 TGCCAGCCCCATAGCGAGGATGG + Intronic
1111939698 13:94596289-94596311 TGCCCGCCCACTAGCGGGCTGGG + Intergenic
1123113178 14:105882388-105882410 TGCCAGCCTCCTAGAGGGTATGG - Intergenic
1123115528 14:105892540-105892562 TGCCAGCCTCCTAGAGGGTATGG - Intergenic
1123119773 14:105911256-105911278 TGCCAGCCTCCTAGAGGGTATGG - Intergenic
1124269518 15:28267940-28267962 TGCCAGCCCCATGGAGTGATGGG - Intronic
1125156419 15:36591877-36591899 TGCCTGGCCCCTAGAGGGATGGG - Intronic
1127077747 15:55344514-55344536 TGCCAACCTCATAGTGGGATGGG + Intronic
1127877375 15:63122441-63122463 TGTCCGCCCCCTAGGGGGAAGGG - Intronic
1131332594 15:91515548-91515570 TGCCAGCGCCTCAGCTGGATGGG + Intergenic
1137629212 16:49930489-49930511 TTCCAGCTGCCTAGCGGGGTAGG + Intergenic
1139599030 16:67975623-67975645 TTCCTTCTCCCTAGCGGGATTGG - Intergenic
1147464453 17:40599875-40599897 TGCCAGCCCCATAGAGAGAAAGG - Intergenic
1148735503 17:49862685-49862707 AGCCAGCCTCCCAGCGGGACAGG - Intergenic
1150687075 17:67329506-67329528 TGTCAGGCCCCTAACTGGATTGG - Intergenic
1159051116 18:63422194-63422216 TCCCAGCTCCCTAGGGGGACGGG + Intronic
1165908907 19:39211864-39211886 TGCCAACCTCCTAGAGGGAGAGG + Intergenic
954716345 3:52528770-52528792 TGCCAGAACCCCAGCTGGATGGG + Intronic
956448703 3:69351747-69351769 TGCCCTGCCCCTAACGGGATAGG + Intronic
963420590 3:145056262-145056284 TGCCAGCCTTCTAGCAGCATGGG + Intergenic
964501027 3:157348189-157348211 TGCCTGCCCCCAAGCAGGAGGGG + Intronic
968830467 4:2930976-2930998 TGCCAGCCCCCTCGGGGACTGGG - Intronic
974203452 4:58669720-58669742 TCCCAGCCCCCGAGAGAGATGGG - Intergenic
974686933 4:65242608-65242630 TGCCAGCTCTGTAGGGGGATGGG + Intergenic
985426228 4:189833356-189833378 TGCCAGACACCTAGTGGGCTCGG + Intergenic
987431859 5:17844783-17844805 TGCCAGCACTCTAGTGGGAGAGG - Intergenic
998103675 5:139455078-139455100 TGCCCGCCCCCTAGCCAGAGTGG + Intronic
998151958 5:139762773-139762795 TGCCATCCCCCTGGCAGGAAAGG - Intergenic
999114237 5:149148581-149148603 TGCCAGCCCCCTTCAGCGATCGG + Intronic
1001764712 5:174236351-174236373 TCCCAGCCCCCTGGATGGATTGG - Intronic
1007384411 6:41510975-41510997 TTCCAGTCTCCTAGCAGGATGGG - Intergenic
1013507499 6:110814941-110814963 TGCCCGCGACCTGGCGGGATGGG - Intronic
1018674220 6:166205270-166205292 TTCCAGCCCCCTTGTGAGATGGG + Intergenic
1021961387 7:25876624-25876646 TGCTAGCCTGCTAGAGGGATGGG - Intergenic
1023806891 7:43878720-43878742 TCCCAGCCCCCAAGGGGCATGGG - Exonic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1029679334 7:102097206-102097228 AGCCAGCCCCCTTGCTGGGTGGG - Intronic
1029699845 7:102239238-102239260 TGCCGTCCCGCTAGCGGGACTGG + Intronic
1034275239 7:149821114-149821136 TGCCAGCCCCGTACCGGAAGCGG - Intergenic
1047249978 8:123174698-123174720 TGCCAGCCCCAAACTGGGATAGG + Intergenic
1048343633 8:133559776-133559798 AGCCAGCTCCCTAGCTAGATGGG - Intronic
1049463868 8:142742260-142742282 TGCCCACCTCCTAGGGGGATGGG - Intronic
1060588424 9:124801119-124801141 AGCCTGCCCCCCAGGGGGATTGG + Intronic
1061140734 9:128764671-128764693 TGCCAGGCCCGCAGCTGGATGGG - Intronic
1189232772 X:39465355-39465377 TGCCAGCCCAGCAGAGGGATGGG - Intergenic
1190792691 X:53714828-53714850 TGCCAGCCCCCTAGCTGTGAGGG + Intergenic
1200128382 X:153828895-153828917 TGCCAGCCCCCTAGCGGGATAGG - Intronic