ID: 1200128747

View in Genome Browser
Species Human (GRCh38)
Location X:153830164-153830186
Sequence GCCAGTGGGGAGGCCCGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 363}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200128747_1200128755 -3 Left 1200128747 X:153830164-153830186 CCGCTCCGGGCCTCCCCACTGGC 0: 1
1: 0
2: 0
3: 28
4: 363
Right 1200128755 X:153830184-153830206 GGCCCGCTCCTCCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 179
1200128747_1200128764 23 Left 1200128747 X:153830164-153830186 CCGCTCCGGGCCTCCCCACTGGC 0: 1
1: 0
2: 0
3: 28
4: 363
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314
1200128747_1200128754 -4 Left 1200128747 X:153830164-153830186 CCGCTCCGGGCCTCCCCACTGGC 0: 1
1: 0
2: 0
3: 28
4: 363
Right 1200128754 X:153830183-153830205 TGGCCCGCTCCTCCCCGCGGAGG 0: 1
1: 0
2: 1
3: 9
4: 167
1200128747_1200128763 20 Left 1200128747 X:153830164-153830186 CCGCTCCGGGCCTCCCCACTGGC 0: 1
1: 0
2: 0
3: 28
4: 363
Right 1200128763 X:153830207-153830229 CCGCGCCCCCGCCGCAGCGCCGG 0: 1
1: 0
2: 7
3: 83
4: 459
1200128747_1200128753 -7 Left 1200128747 X:153830164-153830186 CCGCTCCGGGCCTCCCCACTGGC 0: 1
1: 0
2: 0
3: 28
4: 363
Right 1200128753 X:153830180-153830202 CACTGGCCCGCTCCTCCCCGCGG 0: 1
1: 0
2: 1
3: 15
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200128747 Original CRISPR GCCAGTGGGGAGGCCCGGAG CGG (reversed) Intronic