ID: 1200128749

View in Genome Browser
Species Human (GRCh38)
Location X:153830174-153830196
Sequence GGAGGAGCGGGCCAGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 773
Summary {0: 1, 1: 0, 2: 7, 3: 68, 4: 697}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200128749_1200128763 10 Left 1200128749 X:153830174-153830196 CCTCCCCACTGGCCCGCTCCTCC 0: 1
1: 0
2: 7
3: 68
4: 697
Right 1200128763 X:153830207-153830229 CCGCGCCCCCGCCGCAGCGCCGG 0: 1
1: 0
2: 7
3: 83
4: 459
1200128749_1200128764 13 Left 1200128749 X:153830174-153830196 CCTCCCCACTGGCCCGCTCCTCC 0: 1
1: 0
2: 7
3: 68
4: 697
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200128749 Original CRISPR GGAGGAGCGGGCCAGTGGGG AGG (reversed) Intronic