ID: 1200128751

View in Genome Browser
Species Human (GRCh38)
Location X:153830178-153830200
Sequence GCGGGGAGGAGCGGGCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 366}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200128751_1200128764 9 Left 1200128751 X:153830178-153830200 CCCACTGGCCCGCTCCTCCCCGC 0: 1
1: 0
2: 1
3: 28
4: 366
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314
1200128751_1200128763 6 Left 1200128751 X:153830178-153830200 CCCACTGGCCCGCTCCTCCCCGC 0: 1
1: 0
2: 1
3: 28
4: 366
Right 1200128763 X:153830207-153830229 CCGCGCCCCCGCCGCAGCGCCGG 0: 1
1: 0
2: 7
3: 83
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200128751 Original CRISPR GCGGGGAGGAGCGGGCCAGT GGG (reversed) Intronic