ID: 1200128755

View in Genome Browser
Species Human (GRCh38)
Location X:153830184-153830206
Sequence GGCCCGCTCCTCCCCGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 179}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200128743_1200128755 6 Left 1200128743 X:153830155-153830177 CCACGCCCGCCGCTCCGGGCCTC 0: 1
1: 0
2: 4
3: 70
4: 535
Right 1200128755 X:153830184-153830206 GGCCCGCTCCTCCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 179
1200128734_1200128755 29 Left 1200128734 X:153830132-153830154 CCTCCTCGAGCCCTCCCGCTCTC 0: 1
1: 0
2: 2
3: 36
4: 409
Right 1200128755 X:153830184-153830206 GGCCCGCTCCTCCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 179
1200128748_1200128755 -8 Left 1200128748 X:153830169-153830191 CCGGGCCTCCCCACTGGCCCGCT 0: 1
1: 0
2: 3
3: 44
4: 425
Right 1200128755 X:153830184-153830206 GGCCCGCTCCTCCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 179
1200128742_1200128755 7 Left 1200128742 X:153830154-153830176 CCCACGCCCGCCGCTCCGGGCCT 0: 1
1: 0
2: 4
3: 17
4: 193
Right 1200128755 X:153830184-153830206 GGCCCGCTCCTCCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 179
1200128737_1200128755 18 Left 1200128737 X:153830143-153830165 CCTCCCGCTCTCCCACGCCCGCC 0: 1
1: 0
2: 3
3: 76
4: 765
Right 1200128755 X:153830184-153830206 GGCCCGCTCCTCCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 179
1200128738_1200128755 15 Left 1200128738 X:153830146-153830168 CCCGCTCTCCCACGCCCGCCGCT 0: 1
1: 0
2: 1
3: 15
4: 310
Right 1200128755 X:153830184-153830206 GGCCCGCTCCTCCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 179
1200128744_1200128755 1 Left 1200128744 X:153830160-153830182 CCCGCCGCTCCGGGCCTCCCCAC 0: 1
1: 0
2: 3
3: 42
4: 417
Right 1200128755 X:153830184-153830206 GGCCCGCTCCTCCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 179
1200128747_1200128755 -3 Left 1200128747 X:153830164-153830186 CCGCTCCGGGCCTCCCCACTGGC 0: 1
1: 0
2: 0
3: 28
4: 363
Right 1200128755 X:153830184-153830206 GGCCCGCTCCTCCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 179
1200128739_1200128755 14 Left 1200128739 X:153830147-153830169 CCGCTCTCCCACGCCCGCCGCTC 0: 1
1: 0
2: 2
3: 34
4: 552
Right 1200128755 X:153830184-153830206 GGCCCGCTCCTCCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 179
1200128735_1200128755 26 Left 1200128735 X:153830135-153830157 CCTCGAGCCCTCCCGCTCTCCCA 0: 1
1: 0
2: 3
3: 37
4: 409
Right 1200128755 X:153830184-153830206 GGCCCGCTCCTCCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 179
1200128745_1200128755 0 Left 1200128745 X:153830161-153830183 CCGCCGCTCCGGGCCTCCCCACT 0: 1
1: 0
2: 3
3: 83
4: 792
Right 1200128755 X:153830184-153830206 GGCCCGCTCCTCCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 179
1200128736_1200128755 19 Left 1200128736 X:153830142-153830164 CCCTCCCGCTCTCCCACGCCCGC 0: 1
1: 0
2: 3
3: 38
4: 659
Right 1200128755 X:153830184-153830206 GGCCCGCTCCTCCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200128755 Original CRISPR GGCCCGCTCCTCCCCGCGGA GGG Intronic