ID: 1200128760

View in Genome Browser
Species Human (GRCh38)
Location X:153830196-153830218
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200128760_1200128764 -9 Left 1200128760 X:153830196-153830218 CCCGCGGAGGGCCGCGCCCCCGC 0: 1
1: 0
2: 4
3: 20
4: 239
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314
1200128760_1200128774 27 Left 1200128760 X:153830196-153830218 CCCGCGGAGGGCCGCGCCCCCGC 0: 1
1: 0
2: 4
3: 20
4: 239
Right 1200128774 X:153830246-153830268 ATCACTTTGTACTGCTCCTCCGG 0: 1
1: 0
2: 1
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200128760 Original CRISPR GCGGGGGCGCGGCCCTCCGC GGG (reversed) Intronic