ID: 1200128762

View in Genome Browser
Species Human (GRCh38)
Location X:153830207-153830229
Sequence CCGGCGCTGCGGCGGGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1106
Summary {0: 1, 1: 2, 2: 12, 3: 132, 4: 959}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200128762_1200128775 23 Left 1200128762 X:153830207-153830229 CCGCGCCCCCGCCGCAGCGCCGG 0: 1
1: 2
2: 12
3: 132
4: 959
Right 1200128775 X:153830253-153830275 TGTACTGCTCCTCCGGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1200128762_1200128774 16 Left 1200128762 X:153830207-153830229 CCGCGCCCCCGCCGCAGCGCCGG 0: 1
1: 2
2: 12
3: 132
4: 959
Right 1200128774 X:153830246-153830268 ATCACTTTGTACTGCTCCTCCGG 0: 1
1: 0
2: 1
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200128762 Original CRISPR CCGGCGCTGCGGCGGGGGCG CGG (reversed) Intronic