ID: 1200128764

View in Genome Browser
Species Human (GRCh38)
Location X:153830210-153830232
Sequence CGCCCCCGCCGCAGCGCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 2, 2: 3, 3: 44, 4: 314}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200128760_1200128764 -9 Left 1200128760 X:153830196-153830218 CCCGCGGAGGGCCGCGCCCCCGC 0: 1
1: 0
2: 4
3: 20
4: 239
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314
1200128759_1200128764 -8 Left 1200128759 X:153830195-153830217 CCCCGCGGAGGGCCGCGCCCCCG 0: 1
1: 0
2: 1
3: 24
4: 220
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314
1200128745_1200128764 26 Left 1200128745 X:153830161-153830183 CCGCCGCTCCGGGCCTCCCCACT 0: 1
1: 0
2: 3
3: 83
4: 792
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314
1200128751_1200128764 9 Left 1200128751 X:153830178-153830200 CCCACTGGCCCGCTCCTCCCCGC 0: 1
1: 0
2: 1
3: 28
4: 366
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314
1200128756_1200128764 1 Left 1200128756 X:153830186-153830208 CCCGCTCCTCCCCGCGGAGGGCC 0: 1
1: 0
2: 1
3: 34
4: 357
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314
1200128747_1200128764 23 Left 1200128747 X:153830164-153830186 CCGCTCCGGGCCTCCCCACTGGC 0: 1
1: 0
2: 0
3: 28
4: 363
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314
1200128757_1200128764 0 Left 1200128757 X:153830187-153830209 CCGCTCCTCCCCGCGGAGGGCCG 0: 1
1: 0
2: 0
3: 19
4: 205
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314
1200128750_1200128764 10 Left 1200128750 X:153830177-153830199 CCCCACTGGCCCGCTCCTCCCCG 0: 1
1: 0
2: 3
3: 41
4: 449
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314
1200128748_1200128764 18 Left 1200128748 X:153830169-153830191 CCGGGCCTCCCCACTGGCCCGCT 0: 1
1: 0
2: 3
3: 44
4: 425
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314
1200128749_1200128764 13 Left 1200128749 X:153830174-153830196 CCTCCCCACTGGCCCGCTCCTCC 0: 1
1: 0
2: 7
3: 68
4: 697
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314
1200128758_1200128764 -5 Left 1200128758 X:153830192-153830214 CCTCCCCGCGGAGGGCCGCGCCC 0: 1
1: 0
2: 5
3: 41
4: 464
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314
1200128761_1200128764 -10 Left 1200128761 X:153830197-153830219 CCGCGGAGGGCCGCGCCCCCGCC 0: 1
1: 0
2: 4
3: 36
4: 388
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314
1200128744_1200128764 27 Left 1200128744 X:153830160-153830182 CCCGCCGCTCCGGGCCTCCCCAC 0: 1
1: 0
2: 3
3: 42
4: 417
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314
1200128752_1200128764 8 Left 1200128752 X:153830179-153830201 CCACTGGCCCGCTCCTCCCCGCG 0: 1
1: 0
2: 1
3: 28
4: 393
Right 1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG 0: 1
1: 2
2: 3
3: 44
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200128764 Original CRISPR CGCCCCCGCCGCAGCGCCGG CGG Intronic