ID: 1200128766

View in Genome Browser
Species Human (GRCh38)
Location X:153830213-153830235
Sequence GGGCCGCCGGCGCTGCGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 1, 2: 0, 3: 29, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200128766_1200128774 10 Left 1200128766 X:153830213-153830235 CCCCGCCGCAGCGCCGGCGGCCC 0: 1
1: 1
2: 0
3: 29
4: 354
Right 1200128774 X:153830246-153830268 ATCACTTTGTACTGCTCCTCCGG 0: 1
1: 0
2: 1
3: 12
4: 117
1200128766_1200128775 17 Left 1200128766 X:153830213-153830235 CCCCGCCGCAGCGCCGGCGGCCC 0: 1
1: 1
2: 0
3: 29
4: 354
Right 1200128775 X:153830253-153830275 TGTACTGCTCCTCCGGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200128766 Original CRISPR GGGCCGCCGGCGCTGCGGCG GGG (reversed) Intronic