ID: 1200128767

View in Genome Browser
Species Human (GRCh38)
Location X:153830214-153830236
Sequence AGGGCCGCCGGCGCTGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200128767_1200128775 16 Left 1200128767 X:153830214-153830236 CCCGCCGCAGCGCCGGCGGCCCT 0: 1
1: 0
2: 2
3: 23
4: 231
Right 1200128775 X:153830253-153830275 TGTACTGCTCCTCCGGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1200128767_1200128774 9 Left 1200128767 X:153830214-153830236 CCCGCCGCAGCGCCGGCGGCCCT 0: 1
1: 0
2: 2
3: 23
4: 231
Right 1200128774 X:153830246-153830268 ATCACTTTGTACTGCTCCTCCGG 0: 1
1: 0
2: 1
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200128767 Original CRISPR AGGGCCGCCGGCGCTGCGGC GGG (reversed) Intronic