ID: 1200128769 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:153830218-153830240 |
| Sequence | AGGTAGGGCCGCCGGCGCTG CGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 137 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 123} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1200128769_1200128774 | 5 | Left | 1200128769 | X:153830218-153830240 | CCGCAGCGCCGGCGGCCCTACCT | 0: 1 1: 0 2: 0 3: 13 4: 123 |
||
| Right | 1200128774 | X:153830246-153830268 | ATCACTTTGTACTGCTCCTCCGG | 0: 1 1: 0 2: 1 3: 12 4: 117 |
||||
| 1200128769_1200128775 | 12 | Left | 1200128769 | X:153830218-153830240 | CCGCAGCGCCGGCGGCCCTACCT | 0: 1 1: 0 2: 0 3: 13 4: 123 |
||
| Right | 1200128775 | X:153830253-153830275 | TGTACTGCTCCTCCGGTTTCTGG | 0: 1 1: 0 2: 0 3: 5 4: 71 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1200128769 | Original CRISPR | AGGTAGGGCCGCCGGCGCTG CGG (reversed) | Exonic | ||