ID: 1200128769

View in Genome Browser
Species Human (GRCh38)
Location X:153830218-153830240
Sequence AGGTAGGGCCGCCGGCGCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200128769_1200128775 12 Left 1200128769 X:153830218-153830240 CCGCAGCGCCGGCGGCCCTACCT 0: 1
1: 0
2: 0
3: 13
4: 123
Right 1200128775 X:153830253-153830275 TGTACTGCTCCTCCGGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1200128769_1200128774 5 Left 1200128769 X:153830218-153830240 CCGCAGCGCCGGCGGCCCTACCT 0: 1
1: 0
2: 0
3: 13
4: 123
Right 1200128774 X:153830246-153830268 ATCACTTTGTACTGCTCCTCCGG 0: 1
1: 0
2: 1
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200128769 Original CRISPR AGGTAGGGCCGCCGGCGCTG CGG (reversed) Exonic