ID: 1200128771

View in Genome Browser
Species Human (GRCh38)
Location X:153830233-153830255
Sequence ACAAAGTGATGCTGCAGGTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200128771_1200128775 -3 Left 1200128771 X:153830233-153830255 CCCTACCTGCAGCATCACTTTGT 0: 1
1: 0
2: 0
3: 22
4: 196
Right 1200128775 X:153830253-153830275 TGTACTGCTCCTCCGGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1200128771_1200128779 28 Left 1200128771 X:153830233-153830255 CCCTACCTGCAGCATCACTTTGT 0: 1
1: 0
2: 0
3: 22
4: 196
Right 1200128779 X:153830284-153830306 CATATTACATCCCATGTTGCTGG 0: 1
1: 0
2: 6
3: 57
4: 206
1200128771_1200128774 -10 Left 1200128771 X:153830233-153830255 CCCTACCTGCAGCATCACTTTGT 0: 1
1: 0
2: 0
3: 22
4: 196
Right 1200128774 X:153830246-153830268 ATCACTTTGTACTGCTCCTCCGG 0: 1
1: 0
2: 1
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200128771 Original CRISPR ACAAAGTGATGCTGCAGGTA GGG (reversed) Exonic