ID: 1200128775

View in Genome Browser
Species Human (GRCh38)
Location X:153830253-153830275
Sequence TGTACTGCTCCTCCGGTTTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200128765_1200128775 18 Left 1200128765 X:153830212-153830234 CCCCCGCCGCAGCGCCGGCGGCC 0: 1
1: 2
2: 6
3: 73
4: 672
Right 1200128775 X:153830253-153830275 TGTACTGCTCCTCCGGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1200128769_1200128775 12 Left 1200128769 X:153830218-153830240 CCGCAGCGCCGGCGGCCCTACCT 0: 1
1: 0
2: 0
3: 13
4: 123
Right 1200128775 X:153830253-153830275 TGTACTGCTCCTCCGGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1200128762_1200128775 23 Left 1200128762 X:153830207-153830229 CCGCGCCCCCGCCGCAGCGCCGG 0: 1
1: 2
2: 12
3: 132
4: 959
Right 1200128775 X:153830253-153830275 TGTACTGCTCCTCCGGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1200128768_1200128775 15 Left 1200128768 X:153830215-153830237 CCGCCGCAGCGCCGGCGGCCCTA 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1200128775 X:153830253-153830275 TGTACTGCTCCTCCGGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1200128767_1200128775 16 Left 1200128767 X:153830214-153830236 CCCGCCGCAGCGCCGGCGGCCCT 0: 1
1: 0
2: 2
3: 23
4: 231
Right 1200128775 X:153830253-153830275 TGTACTGCTCCTCCGGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1200128770_1200128775 4 Left 1200128770 X:153830226-153830248 CCGGCGGCCCTACCTGCAGCATC 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1200128775 X:153830253-153830275 TGTACTGCTCCTCCGGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1200128773_1200128775 -8 Left 1200128773 X:153830238-153830260 CCTGCAGCATCACTTTGTACTGC 0: 1
1: 0
2: 2
3: 4
4: 132
Right 1200128775 X:153830253-153830275 TGTACTGCTCCTCCGGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1200128766_1200128775 17 Left 1200128766 X:153830213-153830235 CCCCGCCGCAGCGCCGGCGGCCC 0: 1
1: 1
2: 0
3: 29
4: 354
Right 1200128775 X:153830253-153830275 TGTACTGCTCCTCCGGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1200128772_1200128775 -4 Left 1200128772 X:153830234-153830256 CCTACCTGCAGCATCACTTTGTA 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1200128775 X:153830253-153830275 TGTACTGCTCCTCCGGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1200128771_1200128775 -3 Left 1200128771 X:153830233-153830255 CCCTACCTGCAGCATCACTTTGT 0: 1
1: 0
2: 0
3: 22
4: 196
Right 1200128775 X:153830253-153830275 TGTACTGCTCCTCCGGTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200128775 Original CRISPR TGTACTGCTCCTCCGGTTTC TGG Exonic