ID: 1200128779

View in Genome Browser
Species Human (GRCh38)
Location X:153830284-153830306
Sequence CATATTACATCCCATGTTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200128772_1200128779 27 Left 1200128772 X:153830234-153830256 CCTACCTGCAGCATCACTTTGTA 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1200128779 X:153830284-153830306 CATATTACATCCCATGTTGCTGG 0: 1
1: 0
2: 6
3: 57
4: 206
1200128776_1200128779 -1 Left 1200128776 X:153830262-153830284 CCTCCGGTTTCTGGACCACGCAC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1200128779 X:153830284-153830306 CATATTACATCCCATGTTGCTGG 0: 1
1: 0
2: 6
3: 57
4: 206
1200128777_1200128779 -4 Left 1200128777 X:153830265-153830287 CCGGTTTCTGGACCACGCACATA 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1200128779 X:153830284-153830306 CATATTACATCCCATGTTGCTGG 0: 1
1: 0
2: 6
3: 57
4: 206
1200128773_1200128779 23 Left 1200128773 X:153830238-153830260 CCTGCAGCATCACTTTGTACTGC 0: 1
1: 0
2: 2
3: 4
4: 132
Right 1200128779 X:153830284-153830306 CATATTACATCCCATGTTGCTGG 0: 1
1: 0
2: 6
3: 57
4: 206
1200128771_1200128779 28 Left 1200128771 X:153830233-153830255 CCCTACCTGCAGCATCACTTTGT 0: 1
1: 0
2: 0
3: 22
4: 196
Right 1200128779 X:153830284-153830306 CATATTACATCCCATGTTGCTGG 0: 1
1: 0
2: 6
3: 57
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200128779 Original CRISPR CATATTACATCCCATGTTGC TGG Exonic