ID: 1200135154

View in Genome Browser
Species Human (GRCh38)
Location X:153871209-153871231
Sequence CTCCTGGTCCAGATGGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200135146_1200135154 20 Left 1200135146 X:153871166-153871188 CCACTTGGGGGCACCTAGAAGGG 0: 1
1: 0
2: 2
3: 11
4: 114
Right 1200135154 X:153871209-153871231 CTCCTGGTCCAGATGGTGCTAGG 0: 1
1: 0
2: 1
3: 18
4: 195
1200135150_1200135154 7 Left 1200135150 X:153871179-153871201 CCTAGAAGGGACAGACGGGCTGA 0: 1
1: 0
2: 1
3: 38
4: 684
Right 1200135154 X:153871209-153871231 CTCCTGGTCCAGATGGTGCTAGG 0: 1
1: 0
2: 1
3: 18
4: 195
1200135144_1200135154 27 Left 1200135144 X:153871159-153871181 CCTTTGGCCACTTGGGGGCACCT 0: 1
1: 1
2: 1
3: 14
4: 159
Right 1200135154 X:153871209-153871231 CTCCTGGTCCAGATGGTGCTAGG 0: 1
1: 0
2: 1
3: 18
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200135154 Original CRISPR CTCCTGGTCCAGATGGTGCT AGG Intronic
900658676 1:3772489-3772511 CGCCTGGTCCAGAAGGGGCTGGG - Intergenic
900658718 1:3772585-3772607 CGCCTGGTCCAGAAGGGGCCGGG - Intergenic
901685963 1:10943469-10943491 CTCCTGGATCAGAGGTTGCTGGG + Intergenic
902408230 1:16198219-16198241 GTTCTGGTGCTGATGGTGCTGGG - Exonic
902620584 1:17648491-17648513 CTCATGGCCCAGTTGGTCCTTGG + Intronic
902864786 1:19270748-19270770 CTCCTGGTGCAGCTGGTGGCAGG + Intergenic
902867005 1:19286185-19286207 CTCCTGGTGCAGCTGGTGGCAGG + Exonic
903483295 1:23670282-23670304 CTCCTGGTCCAGATGGGCAAAGG + Intergenic
904674789 1:32192363-32192385 CTCCTGGGCCTGCTGGAGCTTGG - Exonic
904699883 1:32351825-32351847 CTCCTGGTCCAGGCGGTGCGGGG + Intronic
905453924 1:38074642-38074664 CTCCTGGTCCAGATGCTTTTGGG - Intergenic
907110725 1:51924051-51924073 CTACTCTTCCAGGTGGTGCTGGG - Intronic
908608264 1:65825001-65825023 CTACTGATCCAAATGGTACTGGG - Intronic
909357170 1:74723157-74723179 CTCCTGGCTCAGATGTGGCTGGG - Exonic
912451390 1:109769793-109769815 CACCTGGGCCAGGTGCTGCTGGG + Intronic
912827968 1:112923728-112923750 CTCCTGGTGCAGCTGGTGGCAGG - Intronic
918083336 1:181224110-181224132 CTCTTTGACCAGATGGTGTTGGG + Intergenic
920364378 1:205440365-205440387 CTCCTGGGCCAGGTGGGGCCAGG - Intronic
920506160 1:206516972-206516994 CTTCTGGTACAGAGGTTGCTTGG + Intronic
923784582 1:237054948-237054970 CTCCTACTCTAGATGGTGCCGGG + Intronic
1067295469 10:44973044-44973066 CTCCTGGTCCAAGCTGTGCTGGG + Intronic
1068892792 10:62165137-62165159 ATCCTGGTGGAGATGGAGCTTGG - Intergenic
1071643830 10:87342247-87342269 CTCCTGGCCCAGACGCGGCTGGG + Intergenic
1071743170 10:88385668-88385690 ATCCTGGTGCAGAGGTTGCTGGG + Intronic
1072010145 10:91295859-91295881 CGCCTGGACCAGATGGTTCTGGG + Intergenic
1072660685 10:97361711-97361733 CTCTTGGTTCAGCTGGTGCTTGG + Intronic
1073762133 10:106640903-106640925 CTCCTCTTCCAGTTGGTTCTTGG + Intronic
1075811273 10:125226872-125226894 CTCCTGGCCCAGTGGGTCCTGGG + Intergenic
1076574532 10:131454874-131454896 CCCCTGGTACAGATGGTTCCTGG + Intergenic
1076987618 11:250468-250490 CTCCTGGTCAAGGTGCTGTTGGG - Intronic
1076993633 11:288399-288421 GTCCTGGTGCAGCTGCTGCTTGG - Intergenic
1077145639 11:1043066-1043088 GTCCTGGTCCAGAGGGTTGTGGG + Intergenic
1077183841 11:1227822-1227844 CTCCAGGTCCAGGGGGAGCTGGG + Intronic
1077746680 11:4914819-4914841 CACCTGGTCCAGGTGGTCATGGG - Exonic
1078996001 11:16700548-16700570 CTCCTGGTCCAGCTTCTGTTTGG + Intronic
1083678808 11:64342073-64342095 CTGCAGGGCCAGATGGTGCGAGG - Exonic
1083752160 11:64766741-64766763 CTCCTGGTCCAGGGGGTGGAGGG - Intronic
1085552892 11:77391465-77391487 CTTCTGGTTTAGATGGAGCTGGG - Intronic
1085643662 11:78208990-78209012 CTCCAGGTCTAGAGGGTCCTTGG + Intronic
1088557723 11:111079761-111079783 GTCATGGTGCAGAGGGTGCTGGG - Intergenic
1088914918 11:114220179-114220201 CTCTGGGCCCAGATGGTCCTTGG + Intronic
1089554884 11:119310822-119310844 ATCCTGGTCCTGGCGGTGCTGGG - Exonic
1090208411 11:124898318-124898340 CTCCTGGTCCATCTGGCACTGGG - Intronic
1090830021 11:130414744-130414766 CTGCTGGTCCAGCTGGTACAGGG + Exonic
1092159600 12:6308929-6308951 CTCCTGGCCCAGCTGGTGGTGGG - Intergenic
1097905883 12:64919330-64919352 CTGCTGGTACAGTGGGTGCTTGG + Intergenic
1101266532 12:103094051-103094073 CTCCTGGTCAAGACAGTGGTGGG + Intergenic
1103392456 12:120584544-120584566 CTCCTGGGCCAGAAGGGGCCGGG - Intergenic
1104469659 12:129019271-129019293 CTATTGGTTCAGATGGGGCTTGG - Intergenic
1104745553 12:131208106-131208128 CTCCTGGGCCTCACGGTGCTAGG + Intergenic
1104788789 12:131469003-131469025 CTCCTGGGCCTCACGGTGCTAGG - Intergenic
1104842405 12:131831391-131831413 ATGCTGGGCCAGATGGTGCCAGG + Intronic
1105705734 13:22966462-22966484 CGCCTTCTCCAGATGCTGCTCGG - Intergenic
1105858637 13:24391447-24391469 CGCCTTCTCCAGATGCTGCTCGG - Intergenic
1106833649 13:33611539-33611561 CTGCTGGTCCATATTGTGCAAGG + Intergenic
1109391972 13:61705505-61705527 CTGATGGTGCAGATGGAGCTGGG - Intergenic
1109962110 13:69644746-69644768 CTACTGTTCCAGAGGGTGCAAGG + Intergenic
1113135156 13:107080775-107080797 TTTCTGGTCCAGAGGATGCTGGG + Intergenic
1119477460 14:74939377-74939399 CTCCCTGTCCAGATGGCGCGTGG + Intergenic
1119599736 14:75967489-75967511 CTCCTGGTCAAGCTGGTTCAAGG + Intronic
1119682699 14:76604806-76604828 CTCCCAGTTCAGATGGGGCTTGG + Intergenic
1121588469 14:95080465-95080487 GTCCTGCTGCAGATGCTGCTGGG - Intergenic
1122859656 14:104576855-104576877 CTCCTGCTACAGAGGGAGCTGGG + Intronic
1124369510 15:29095910-29095932 CTCCTAGTCCAGCTGGAGCAGGG + Intronic
1125511999 15:40297131-40297153 CTCCTGGTGCAGATGGCCTTGGG - Intronic
1126100454 15:45115473-45115495 CTCCTGGTCCAGTCACTGCTTGG - Intronic
1129407382 15:75328481-75328503 TGCCTGGGCCAAATGGTGCTAGG + Intergenic
1129657082 15:77531488-77531510 CACCTGATCCAGACGTTGCTGGG + Intergenic
1132151732 15:99467086-99467108 CTCCTGGTGCAGACAGTGCCGGG + Intergenic
1132762978 16:1519943-1519965 CTCCTGGTCCAGGGGGCTCTTGG + Exonic
1133604899 16:7377264-7377286 CTCCTGGAGCAGATGATACTGGG + Intronic
1133814081 16:9183190-9183212 TTCCTGGTGCTGATGGCGCTTGG - Intergenic
1134127632 16:11627296-11627318 CTGCTGGCAAAGATGGTGCTGGG - Intronic
1135329037 16:21545887-21545909 GGGCTGGTCCAGATGGAGCTGGG - Intergenic
1135329783 16:21551421-21551443 CCCCAGGTCCAGGTAGTGCTGGG + Intergenic
1136296552 16:29307324-29307346 CTCCTGGTGCAGGAGGTGCCAGG + Intergenic
1136339383 16:29631864-29631886 GGGCTGGTCCAGATGGAGCTGGG - Intergenic
1136340123 16:29637391-29637413 CCCCAGGTCCAGGTAGTGCTGGG + Intergenic
1138521997 16:57576296-57576318 CTACTGGTCCAGATGGTCTATGG - Exonic
1140657473 16:77155472-77155494 CCCCTGATCCAGCTGGAGCTGGG - Intergenic
1141880504 16:86855867-86855889 CTCCTGATCTAGATGGAGTTGGG - Intergenic
1142042049 16:87900451-87900473 AGGCTGGTCCAGATGGAGCTGGG - Intronic
1142188277 16:88705216-88705238 CTCCTGGTACAGAGGGAGCTGGG - Intronic
1144737970 17:17565440-17565462 CTCCCGGTTCAGAAGATGCTGGG - Intronic
1148134332 17:45282641-45282663 CTCCTGATCTAGATGCTGATTGG - Intronic
1151005230 17:70428063-70428085 CACCTGTTCCTGAGGGTGCTAGG - Intergenic
1151568874 17:74916177-74916199 CTCCTGGTTCTTCTGGTGCTGGG - Exonic
1152505589 17:80747680-80747702 CCCGTGGTCCAGACGCTGCTGGG - Intronic
1152667578 17:81580182-81580204 CACATGGTACAGATGGTGTTGGG - Intronic
1152884646 17:82842407-82842429 CTCCTGGTCGAGGTGTTGTTTGG + Intronic
1157105542 18:44771320-44771342 TACCTGGTCTAGATGGTGCATGG + Intronic
1157579290 18:48764133-48764155 CTCCTACTTCAGGTGGTGCTAGG + Intronic
1158294102 18:55974945-55974967 CTCATGATTCACATGGTGCTGGG + Intergenic
1160235472 18:77082679-77082701 CACCTGGTCCAGCTGCTGCAGGG - Intronic
1160666015 19:328850-328872 CTCTTGTTCCAGATCGTGATGGG - Intronic
1161175033 19:2836848-2836870 CTCCTGGTCTTGATTTTGCTAGG - Intergenic
1162902107 19:13801241-13801263 CTTCAGGTCCAGATGGGGTTGGG + Intronic
1166561164 19:43733243-43733265 CTCCTAGACCAGTGGGTGCTGGG + Intronic
1166792678 19:45407082-45407104 CTTCTGCTGCAGATGCTGCTCGG + Exonic
1167096997 19:47379888-47379910 CTCCTCCTCCAGCTGCTGCTGGG - Exonic
1202633451 1_KI270706v1_random:20955-20977 ATCCTGGCCCAAATGGTACTTGG - Intergenic
928023493 2:27721717-27721739 TTCCTGCTCCAGGTGGTGCCAGG - Intergenic
929948414 2:46387993-46388015 CTCCTGCTCCTGGGGGTGCTGGG + Intergenic
935339662 2:102048461-102048483 CTCCTGCTCCAGAAATTGCTGGG - Intergenic
937230751 2:120396858-120396880 CTCCTGGCCCTGAGGGTGGTTGG + Intergenic
937356798 2:121202852-121202874 CACCTGGGCCAGCTGGTGCAAGG - Intergenic
937903674 2:127041232-127041254 CTCCTGGAGCAGATGTTGCTAGG - Intergenic
937913931 2:127089739-127089761 CTGCTGGGGCAGAAGGTGCTGGG + Intronic
938018339 2:127885815-127885837 CTCCTGGCCCAGACGCGGCTGGG + Exonic
939405457 2:141749883-141749905 TTCCTGGTTCAGATAGTGATGGG - Intronic
939936178 2:148296648-148296670 CTCGTGGTCCAGATGGAGGCAGG + Intronic
945043926 2:205765413-205765435 CTCCTAGTCCAAACGGTGCAAGG - Intronic
946440862 2:219694018-219694040 CTCCTGGTCCTGATGGTGGCTGG + Intergenic
947523180 2:230864013-230864035 CTCCTGGTCCAGACTGGGCCAGG - Intergenic
947701759 2:232240242-232240264 CTCCTGGAGCAGGTGGAGCTAGG - Intronic
947887548 2:233585684-233585706 CTCCTGGTCCAGATCCTCCAGGG - Intergenic
947893669 2:233648080-233648102 CTCCTGGTCCAGATCCTCCAGGG - Intronic
948537408 2:238656447-238656469 CTCCTGGTCTAGTTGGGGGTGGG - Intergenic
1173159669 20:40643117-40643139 CTCTGGGGCCAGATGGGGCTGGG + Intergenic
1173174562 20:40754621-40754643 TTCCTGGTCCAGATGGCCCACGG + Intergenic
1173485882 20:43440725-43440747 CTCCTGGTCCACACCGTGCCAGG + Intergenic
1175282546 20:57813818-57813840 CTCCAGCCCCAGATGGTGGTGGG + Intergenic
1175420927 20:58833019-58833041 CACCTGGTGGAGATGGTGCAGGG - Intergenic
1175863854 20:62164151-62164173 CTCCTGGCCCAGGTACTGCTGGG - Exonic
1177533441 21:22394383-22394405 CTCCTGGTAGAGATAGTGTTTGG - Intergenic
1178254952 21:31043986-31044008 CTCCTGCTGCAGATGCTGCCCGG + Intergenic
1179011560 21:37560406-37560428 TTCCTGGTGCAGGTGCTGCTTGG + Intergenic
1179495870 21:41771036-41771058 GTCCTGGTCAGGGTGGTGCTGGG - Intergenic
1180225763 21:46391230-46391252 CTCCAGCACCAGACGGTGCTCGG - Exonic
1180600482 22:17012250-17012272 CTCCTGGCACAGGTGCTGCTTGG + Intergenic
1183618876 22:38961314-38961336 CGCCTGGACCAGGTGGGGCTGGG - Intronic
1183624079 22:38991259-38991281 CGCCTGGACCAGGTGGGGCTGGG - Intronic
1184758984 22:46534294-46534316 CTCCCGGTCCAGCCGGCGCTGGG + Exonic
949651703 3:6167354-6167376 CTTCTGGTACAGCTGGTTCTAGG + Intergenic
950789493 3:15461262-15461284 CTGTGGGACCAGATGGTGCTGGG - Intronic
953418359 3:42735824-42735846 TTGCTGGTCCAGGTGGTGCTGGG + Exonic
953726837 3:45406974-45406996 CTTCTGGACCAGAAGGTGCTGGG - Intronic
953868776 3:46607981-46608003 CTCCTGTTCCACATGGGTCTGGG + Intronic
954150119 3:48653113-48653135 CACCTGGTCCAGAAGGAGATGGG + Exonic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
961056694 3:123794614-123794636 CTCCTGGTCCAGGGCCTGCTGGG + Intronic
961554586 3:127689346-127689368 CTCCACTTCCAGGTGGTGCTGGG - Exonic
961756260 3:129128829-129128851 CCCCTGGGCAAGATGGTGCCTGG - Intronic
962353991 3:134678073-134678095 CACCTGGGCCACCTGGTGCTGGG + Intronic
962755704 3:138464217-138464239 CTCCTGGTCCAGACCGTGGAGGG + Intronic
963106035 3:141648037-141648059 ACACTGGTCCAGATGTTGCTGGG - Intergenic
963811130 3:149777510-149777532 CTCCTGTTCCAGAAGGTGCATGG + Intronic
964643502 3:158934319-158934341 TCCCTGGTCCACATGGTGATAGG - Intergenic
965553837 3:169999303-169999325 CTTCAGGTCCACATGGTCCTTGG - Intergenic
966112226 3:176417038-176417060 CTCCTGTTCCAGGTGGTACCTGG - Intergenic
966246845 3:177818135-177818157 CTCCTGTACCAGAAGGTGCTTGG - Intergenic
966947441 3:184786941-184786963 CTCCTGGGCAAGATGGTGCTGGG + Intergenic
968448860 4:665832-665854 CACCTGGTCCACGTGGGGCTGGG - Intronic
969939188 4:10713402-10713424 CTCCTGTCCAAGATGGTGCTAGG + Intergenic
969957613 4:10907893-10907915 CTCCTAGTTCAGAGGGGGCTAGG + Intergenic
970596141 4:17602143-17602165 GTCCTGGTACTGATGGTGGTGGG + Intronic
971311620 4:25530157-25530179 CTCCGGGTGCAGATGGTGGCAGG - Intergenic
972822434 4:42717023-42717045 GTGCTGGCCCAGCTGGTGCTGGG + Intergenic
973605101 4:52579066-52579088 CTGCTGGTGCTGCTGGTGCTGGG + Intergenic
977936651 4:102813666-102813688 CTCCTGGAACAGAAGGTCCTAGG + Intronic
982525354 4:156470964-156470986 CTCCTGGGGCAGATGGGGCATGG + Intergenic
984067990 4:175073587-175073609 CTCCTGGTAAAGATGCTGCGAGG - Intergenic
985639943 5:1058916-1058938 CTCCTGGGCCAGGTGGGGGTTGG - Intronic
986275581 5:6272287-6272309 CTGCTGCTCCAGATGCTGGTTGG - Intergenic
991006351 5:61832085-61832107 ATCCTGATCCTCATGGTGCTGGG + Intergenic
992657420 5:78923954-78923976 CTCCTTTTCCAGGGGGTGCTGGG + Intronic
992864041 5:80940028-80940050 ATCCTGGTCCAGATACTACTGGG - Intergenic
997522855 5:134534456-134534478 ATCCTGGTCCTGCTGGTGGTGGG + Intronic
997729856 5:136161067-136161089 TTCCTGGTCCAGAACTTGCTGGG - Exonic
997791883 5:136769238-136769260 CTCCTTCTCCAGGTGGTGGTGGG + Intergenic
999868637 5:155728310-155728332 CTCCGGCTCCAGCTGGGGCTTGG - Intergenic
1001254063 5:170170444-170170466 CTTGTGGGCCAGATGGTTCTTGG + Intergenic
1001391524 5:171383295-171383317 TTCCTGGTTCAGACGGAGCTTGG - Intergenic
1002415288 5:179117278-179117300 AGCCTGGGCCTGATGGTGCTGGG + Intronic
1004048270 6:12047483-12047505 CTCGTGGTCCCCACGGTGCTGGG + Intronic
1005019483 6:21404058-21404080 CTCCTGTTCCAGCTGCTGCTGGG + Intergenic
1006581162 6:35078709-35078731 TTCTTGGTGCAGGTGGTGCTAGG - Intronic
1007418367 6:41705281-41705303 CTCATTGTTCAGATGGAGCTGGG - Intronic
1007619025 6:43200424-43200446 TTCCGGCTGCAGATGGTGCTGGG + Exonic
1007701008 6:43766586-43766608 CTCCAGATCCACATGGGGCTAGG + Intergenic
1007909040 6:45494722-45494744 CTGCTGCTCCAGATGTTCCTGGG - Intronic
1008887148 6:56444061-56444083 CTCCTGGGCAAGACGGTGCAAGG + Intergenic
1013356953 6:109353971-109353993 CACTTGGTCAAGATGGTGTTTGG - Intergenic
1017822590 6:158060173-158060195 CTCCTGGACCTGCTGCTGCTGGG + Intronic
1018416486 6:163606378-163606400 ATCCTTCTCCATATGGTGCTGGG - Intergenic
1019340775 7:507831-507853 CTCCAGGTCCAGGTGTGGCTGGG - Intronic
1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG + Intergenic
1022844778 7:34199029-34199051 TTCCTGATCCAGACAGTGCTTGG + Intergenic
1022891244 7:34702130-34702152 CTCATGGTACAGATGGCGGTTGG + Intronic
1023066641 7:36384488-36384510 CTCATGTGCCAGAAGGTGCTGGG + Intronic
1023911932 7:44562504-44562526 CTCCAGGTCCAGAGGTTTCTGGG + Intergenic
1023970470 7:44987008-44987030 CTCCGTGTCCACATCGTGCTTGG - Intergenic
1026457745 7:70587470-70587492 CACCTGGCCTAGATGGTCCTTGG + Intronic
1028754519 7:94420255-94420277 CTGCTGGTCCTGCTGGTCCTCGG + Exonic
1029685309 7:102143195-102143217 TTCCTGGGTCAGATGGTACTTGG + Intronic
1034947145 7:155269834-155269856 CTCCTGGTCCTGCTGCTGCTCGG - Intergenic
1043578856 8:81688753-81688775 TTCCTGGTCCAGTTGTAGCTAGG - Intergenic
1043582821 8:81733329-81733351 CTCCTGGTCCAGCTTTTTCTAGG + Intronic
1045112502 8:98948240-98948262 CTCCTGGGCCAGAGGGCCCTGGG - Exonic
1046671849 8:117064786-117064808 CTCCTCTCCCAGATGGGGCTGGG - Intronic
1048419898 8:134267861-134267883 CTCATTGTCCACATGATGCTTGG + Intergenic
1048419965 8:134268390-134268412 CTCATTGTCCACATGCTGCTTGG - Intergenic
1049613557 8:143566952-143566974 CTCCTGGCCCAGATGGCACCTGG - Exonic
1056724963 9:89106624-89106646 ACCCTGCTCCAGATGGTCCTGGG + Intronic
1059049588 9:110909328-110909350 CTCCTGTACAAGAAGGTGCTAGG - Intronic
1059350731 9:113662985-113663007 TTTCTTATCCAGATGGTGCTTGG + Intergenic
1059447590 9:114348529-114348551 CTCCCGGTTCAGGTGGTGCTAGG - Intronic
1062552593 9:137096714-137096736 CTGCTCGACCAGATGGGGCTCGG - Intronic
1062606075 9:137349446-137349468 CTCCTGGTGCAGCAGGTGCTGGG - Exonic
1187895966 X:23979896-23979918 CTCCCAATCCAGATGGTGGTGGG + Intergenic
1195065625 X:101235885-101235907 CACCTCCTCAAGATGGTGCTGGG + Exonic
1195752674 X:108174144-108174166 CTCCTGGAGGAGATGGTGCCTGG + Intronic
1200107384 X:153722835-153722857 CTCTTGGTCCACGGGGTGCTGGG - Intronic
1200123519 X:153802489-153802511 CCCCTGCTCCAGATGGTGTGGGG + Exonic
1200135154 X:153871209-153871231 CTCCTGGTCCAGATGGTGCTAGG + Intronic