ID: 1200136528

View in Genome Browser
Species Human (GRCh38)
Location X:153877762-153877784
Sequence CCTAACCTGGAGCATCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200136528_1200136539 7 Left 1200136528 X:153877762-153877784 CCTTCCAGATGCTCCAGGTTAGG 0: 1
1: 0
2: 2
3: 21
4: 216
Right 1200136539 X:153877792-153877814 CAGGGGTCAGGACAAGCTCTGGG 0: 1
1: 0
2: 1
3: 26
4: 239
1200136528_1200136537 -5 Left 1200136528 X:153877762-153877784 CCTTCCAGATGCTCCAGGTTAGG 0: 1
1: 0
2: 2
3: 21
4: 216
Right 1200136537 X:153877780-153877802 TTAGGGTCAGGACAGGGGTCAGG 0: 1
1: 0
2: 1
3: 65
4: 364
1200136528_1200136538 6 Left 1200136528 X:153877762-153877784 CCTTCCAGATGCTCCAGGTTAGG 0: 1
1: 0
2: 2
3: 21
4: 216
Right 1200136538 X:153877791-153877813 ACAGGGGTCAGGACAAGCTCTGG 0: 1
1: 0
2: 2
3: 17
4: 228
1200136528_1200136536 -10 Left 1200136528 X:153877762-153877784 CCTTCCAGATGCTCCAGGTTAGG 0: 1
1: 0
2: 2
3: 21
4: 216
Right 1200136536 X:153877775-153877797 CCAGGTTAGGGTCAGGACAGGGG 0: 1
1: 0
2: 1
3: 32
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200136528 Original CRISPR CCTAACCTGGAGCATCTGGA AGG (reversed) Intronic
900274772 1:1817757-1817779 CCACACCTGGAGCCTCGGGAGGG - Intronic
901738607 1:11327923-11327945 CCTCTCCTGGACCCTCTGGATGG + Intergenic
902755039 1:18543412-18543434 ATTATCCTGGAGCATCTGGGAGG + Intergenic
903366341 1:22807615-22807637 CTTTACTGGGAGCATCTGGAGGG - Intronic
903428199 1:23270552-23270574 TCTCCCCTGGAGCCTCTGGAAGG + Intergenic
905243919 1:36599205-36599227 CCTGATGTGGAGCATCTGGGAGG - Intergenic
905338853 1:37264558-37264580 CCTAACCCAGAGCAGCAGGAAGG + Intergenic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
906188232 1:43878073-43878095 TATGACCTAGAGCATCTGGAGGG - Intronic
907413912 1:54301236-54301258 CCTCACCTGGACCATTTGGCAGG + Intronic
909873552 1:80776313-80776335 GCTCATCTGGAGCATCTGGGAGG - Intergenic
910564103 1:88624138-88624160 CCTAATATCGAGCATCTGTAAGG + Intergenic
910864951 1:91779899-91779921 TCTCTCCTGGAGCCTCTGGAGGG - Intronic
910941478 1:92539637-92539659 CCTAACCTGGGGCCCATGGATGG - Intronic
911576560 1:99585300-99585322 ACTATCCTGTAGCATGTGGAAGG - Intergenic
911826936 1:102498814-102498836 CCTAACCTAGAGGATTTAGAAGG - Intergenic
912490360 1:110059449-110059471 CATTTCCTGGGGCATCTGGAAGG + Intronic
913214647 1:116610287-116610309 GCTAACCTGGAGCAACGGAAAGG - Intronic
914212975 1:145598187-145598209 AATAACCTGGAGTCTCTGGAAGG + Intergenic
915171021 1:153977347-153977369 CCTGACCTGGAACCTCTGGGAGG - Exonic
915604915 1:156944370-156944392 CCTGACCTGGAGGATCAGCAAGG - Exonic
919646025 1:200095434-200095456 CCTGACCTTGAGCACCTGGCTGG + Intronic
920346593 1:205309789-205309811 CCTGCCCTGGATCCTCTGGATGG - Intronic
922810182 1:228410940-228410962 GCTCACCTGCAGCATCTGGAGGG + Exonic
923357687 1:233176716-233176738 CCCAGCCTAGAGCATCTTGATGG - Intronic
924500063 1:244629257-244629279 CATCACCTGGACCATCTAGACGG + Intronic
1064006829 10:11705430-11705452 CCTAGCCTGCCGCAGCTGGAGGG + Intergenic
1066446399 10:35487696-35487718 CCTTACCTTCAGCCTCTGGAGGG - Intronic
1066495859 10:35941174-35941196 AATAACCTGGTGCAGCTGGAAGG + Intergenic
1069605222 10:69734778-69734800 CCTAACCTGGAGCCTCTTCTTGG - Intergenic
1070323868 10:75374956-75374978 CCCAACCAGGAGCTTCTTGAGGG + Intergenic
1074311069 10:112323811-112323833 CCTTCCCTAGAGCTTCTGGAGGG + Intergenic
1076228178 10:128797787-128797809 ATTACCCTGGATCATCTGGATGG + Intergenic
1077049017 11:558427-558449 CCTAACCCTGCGCATGTGGATGG - Intronic
1077166928 11:1146502-1146524 CCTCCCCTGGAGCCTCTGGAAGG - Intergenic
1077592157 11:3500543-3500565 CCCAACCTGGACCGTCTGGCCGG - Intergenic
1079588824 11:22157684-22157706 CCTCAGAAGGAGCATCTGGAAGG + Intergenic
1084247985 11:67873283-67873305 CCCAACATGGACCATCTGGCCGG - Intergenic
1084824827 11:71722209-71722231 CCCAACCTGGACCGTCTGGCCGG + Intergenic
1084847970 11:71915566-71915588 CCAAACCTGGAACATCTCCAAGG + Intronic
1085734999 11:79031369-79031391 CCTAGCCTGGACCATCTGTTGGG - Intronic
1087021852 11:93611063-93611085 TCTCCCCTGGAGCCTCTGGAGGG - Intergenic
1089625515 11:119748529-119748551 CCTCACCTGGCCCAGCTGGAGGG + Intergenic
1090494028 11:127192318-127192340 CCTAACCTAGACCATCTTAAAGG - Intergenic
1090629503 11:128633766-128633788 CCTGACTTGGAGCACCTGCATGG - Intergenic
1092418275 12:8308674-8308696 CCCAACCTGGACCGTCTGGCCGG - Intergenic
1096521748 12:52188412-52188434 CCTAAACTGGAACTCCTGGAGGG + Intronic
1097643959 12:62214076-62214098 CTTAACCTGGTGCATCTTAATGG - Intronic
1102021389 12:109685878-109685900 CCAAGCTTGGATCATCTGGAGGG + Intergenic
1103061724 12:117863758-117863780 TCTTGCCTGGAGCCTCTGGAAGG - Intronic
1103976109 12:124703792-124703814 CCTCCTCTGGAGCTTCTGGAAGG + Intergenic
1103989680 12:124790481-124790503 TCTCCCCTGGAGCCTCTGGAAGG + Intronic
1106226587 13:27791080-27791102 CCAAACCCGAAGCATCTGCATGG - Intergenic
1106478537 13:30118746-30118768 TCTCTCCTGGAGCCTCTGGAGGG + Intergenic
1107636957 13:42402055-42402077 CCTAACCTGGAGGATCGTTATGG + Intergenic
1108219661 13:48220393-48220415 TCTCACCTGGAGCATCTGGAGGG + Intergenic
1108626313 13:52232226-52232248 CCAAACCTGGATTATTTGGAAGG - Intergenic
1108659754 13:52574256-52574278 CCAAACCTGGATTATTTGGAAGG + Intergenic
1113632439 13:111897518-111897540 CCTGACCTGGTGCATCTGGGAGG - Intergenic
1113747732 13:112756632-112756654 CCTCACCTGGAGAGCCTGGACGG + Intronic
1117119350 14:52552151-52552173 CCTCACCTGGAGCCTCCTGAGGG - Intronic
1117215300 14:53545465-53545487 CCTAACCTAGAACATCTGGCAGG - Intergenic
1117790064 14:59331240-59331262 CCTCGCCTGGAGCACCAGGAGGG + Exonic
1119265752 14:73262545-73262567 CCCAGCCTGGGGCTTCTGGAAGG + Exonic
1119678653 14:76575431-76575453 CCTCCCCTAGAGCTTCTGGAGGG - Intergenic
1123216716 14:106814813-106814835 CCCATCCAGGAACATCTGGAGGG + Intergenic
1124050894 15:26196852-26196874 TCTCCCCTGGAGCCTCTGGAGGG + Intergenic
1125727264 15:41874461-41874483 CCTAGGCTGGAGCTTCTGCAGGG - Exonic
1126808224 15:52374713-52374735 TCTCCCCTGGAGCTTCTGGAAGG + Intronic
1126843008 15:52735386-52735408 CCTAGCCTGGGGCATCAGGAAGG - Intergenic
1127857316 15:62963127-62963149 CCTCACCTGGAGCCTGAGGATGG - Intergenic
1129048065 15:72754647-72754669 CTTAACCTGAACCTTCTGGATGG - Intronic
1129780677 15:78268642-78268664 ACTAAACTGTAGCCTCTGGAGGG + Intronic
1130748699 15:86686005-86686027 CCTGACCTGGAACATCTAGTGGG - Intronic
1131305211 15:91236765-91236787 CATTACCTGGGGCAGCTGGAAGG + Intronic
1132224798 15:100132097-100132119 CCCATCCCGGAGCATGTGGACGG - Exonic
1132648882 16:1011570-1011592 CCTCACCTGGGGCTTCCGGAGGG + Intergenic
1139001837 16:62520120-62520142 CTTAAGCTGGAGCAACTGTAGGG - Intergenic
1139178981 16:64723498-64723520 CTGCACCTGGAACATCTGGATGG - Intergenic
1140718093 16:77745073-77745095 CCTAACATGGGTCACCTGGAAGG + Intergenic
1141369096 16:83470918-83470940 TCTCCCCTGGAGCCTCTGGAAGG - Intronic
1141763677 16:86045094-86045116 CCTTCCCTAGAGCCTCTGGAGGG + Intergenic
1144095605 17:11897945-11897967 CCTTCCCTAGAGCCTCTGGAGGG - Intronic
1144467747 17:15509782-15509804 TCTAACCTGGAGCATCAGAGGGG - Intronic
1144721393 17:17472684-17472706 CATAACCTGGAGCCTCAGGCAGG - Intergenic
1144752257 17:17657239-17657261 CCTTCCCTAGAGCCTCTGGAGGG - Intergenic
1146113451 17:30112608-30112630 GCTAACTTGTAGCATCTTGAAGG - Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1150589346 17:66548656-66548678 CCTATCCTGGACTATCTGCATGG + Intronic
1151540486 17:74762281-74762303 GCCAACCTGGAGCTGCTGGATGG + Intronic
1152302680 17:79504517-79504539 TCTCTCCTGGAGCCTCTGGAGGG - Intronic
1152372911 17:79901617-79901639 CCTCCCCTAGAGCCTCTGGAGGG - Intergenic
1152542666 17:80984180-80984202 CCTCACCTGAAGCATCTGCCTGG + Intergenic
1152581972 17:81169612-81169634 CCTCCCCTGGAGCATCTGGAGGG - Intergenic
1157718048 18:49902705-49902727 CCTGGCCTTGAGCATCCGGAAGG + Exonic
1159703694 18:71660850-71660872 CCTATCCATGAGCATTTGGAAGG + Intergenic
1159950089 18:74476566-74476588 ACTATCCTGGATCATCTGGGTGG + Intergenic
1160076666 18:75683690-75683712 CCCACGCTGGAGCTTCTGGATGG + Intergenic
1160876895 19:1300595-1300617 CCCAACCTGGAGCACCAGGGGGG - Intergenic
1161148151 19:2692012-2692034 CCTTCCCTGGAGCCTCTAGAAGG + Intronic
1161303181 19:3552938-3552960 CCCAGCCTGGGGCACCTGGAAGG + Intronic
1161984288 19:7645265-7645287 CGTAACCTGGAGCAGCTGGGAGG + Exonic
1163755270 19:19102926-19102948 CCTCCCCTAGAGCCTCTGGAGGG - Intronic
1163773890 19:19206752-19206774 CTTAGCCTGGGGCATCTGCAAGG + Intergenic
1163820656 19:19494703-19494725 CCTCACCTGGAGGCCCTGGAAGG - Intronic
1164779215 19:30879186-30879208 CCTAGCATGGAGCATCAGCAAGG - Intergenic
1165003913 19:32788833-32788855 CCTTCCCTTGGGCATCTGGACGG - Intronic
1167548802 19:50145325-50145347 CCATCCCTGGAGCCTCTGGAGGG + Intergenic
925130170 2:1488824-1488846 CCTCACCAGTGGCATCTGGAAGG + Intronic
926462936 2:13155666-13155688 CTTAACCTGGAGCCCATGGATGG + Intergenic
927500992 2:23583100-23583122 CCTCCCCTGGAGCATCCAGAGGG + Intronic
928343314 2:30465355-30465377 TCTCACCTGGAGCCTTTGGAGGG + Intronic
930007254 2:46907946-46907968 CATATCATGGAGCATCTAGAAGG - Exonic
930708964 2:54531841-54531863 CTTGACCTGGAGCACCTGGCAGG + Intronic
931385372 2:61793574-61793596 CTTCACCTGGAGCATCAGGGCGG - Intergenic
932402922 2:71494565-71494587 CCTAGCCTGGTACATGTGGAAGG - Intronic
932746500 2:74337983-74338005 CCTGACATGGAGCCTCTGGAGGG + Intronic
934855577 2:97727383-97727405 CCTGCCCTGCTGCATCTGGAGGG + Intronic
936111921 2:109671545-109671567 CTTCTCCTGGAGAATCTGGAGGG + Intergenic
942608980 2:177722041-177722063 CCTGACCTGGAGGATTTGGCTGG + Intronic
944556484 2:200892249-200892271 CATAACCTGGAACACATGGAAGG + Exonic
946060551 2:216937316-216937338 GCTGCCCTGGAGCTTCTGGAAGG - Intergenic
946064085 2:216971352-216971374 CCTAACTTTGAGCACCTAGAAGG - Intergenic
946520120 2:220455487-220455509 ACAAACATGAAGCATCTGGATGG - Intergenic
1173946768 20:46957688-46957710 TCTCACCTGGAGCCTCTGGATGG + Intronic
1175391878 20:58632607-58632629 CCTCACCTAGAGCTTTTGGAGGG + Intergenic
1175733109 20:61367495-61367517 CCCAACCTTGAGCAGCTTGAAGG + Intronic
1175733117 20:61367530-61367552 CCCAACCTTGAGCAGCTTGAAGG + Intronic
1176228781 20:64019730-64019752 CCTGACCAGGAGCATCTGAGGGG - Intronic
1176297300 21:5080909-5080931 CCTCATCTGGAGCATAAGGATGG - Intergenic
1176671344 21:9737991-9738013 CCTGAGCTGCAGCATCTGGTTGG + Intergenic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1179565809 21:42247920-42247942 CCTCCCCTGGAGCCTCCGGAGGG + Intronic
1179859729 21:44181039-44181061 CCTCATCTGGAGCATAAGGATGG + Intergenic
1181895089 22:26100040-26100062 TCTTACCTGGAGGACCTGGATGG + Intergenic
1182314451 22:29435347-29435369 TCTTCCCTGGAGCATCTGAAAGG + Intergenic
1182554486 22:31121878-31121900 ACCAACATGGAGCATCTGCATGG - Intergenic
1183789031 22:40050068-40050090 GCAACCCTGGAGCATTTGGAGGG + Intronic
1183877685 22:40797936-40797958 CCTGACCTGGAACCTCTGCAAGG + Intronic
1184498930 22:44860342-44860364 CCTTCCCTAGAGCCTCTGGAAGG - Intronic
1185324088 22:50217188-50217210 CCGCACCTGGAGGATCAGGAGGG - Exonic
949901076 3:8815193-8815215 CCTCCCCTGGAGCCTCTGGAGGG + Intronic
953929383 3:46998394-46998416 CCTGGCCTGGAGGATCTGAAGGG + Intronic
954901933 3:54027222-54027244 CCAAACCTGGGACATCTGCAGGG + Intergenic
955902825 3:63775345-63775367 TCCAACCTGGAACATCTGGGTGG + Intergenic
956405279 3:68922324-68922346 CCAATGCTGGAGCACCTGGAAGG - Intronic
958959532 3:100495690-100495712 CCCAACCTGCAGGACCTGGATGG - Intronic
961895963 3:130167885-130167907 CCCAACCTGGACCGTCTGGCCGG - Intergenic
961915383 3:130368864-130368886 CCATTTCTGGAGCATCTGGAAGG - Intronic
965056621 3:163725353-163725375 TCTAACCTAGAGGCTCTGGAAGG - Intergenic
965781344 3:172289338-172289360 CTTAACCTGGATTATCTGGCTGG - Intronic
968047055 3:195630385-195630407 CCTCCCCTGGAGCCTCTGGAGGG - Intergenic
968307594 3:197659659-197659681 CCTCCCCTGGAGCCTCTGGAGGG + Intergenic
969078956 4:4603386-4603408 CCTCCCCCGGAGCCTCTGGAGGG + Intergenic
969192382 4:5532755-5532777 CTTCACCTTGAGCATCTCGAGGG - Intergenic
969604835 4:8197246-8197268 CCTCCCCTGGAGCTTCTGGAGGG + Intronic
969746804 4:9079081-9079103 CCCAACCTGGACCATCTGGCTGG + Intergenic
970695351 4:18670361-18670383 TCTCCCCTGGAGCCTCTGGAAGG + Intergenic
974397204 4:61352773-61352795 CCTAACCTGCAGTATCTCCAAGG + Intronic
975089954 4:70389860-70389882 GATAACCTGGGGCATCAGGATGG - Exonic
979400386 4:120242361-120242383 CCTAATCTGTAGAATCTGTAGGG + Intergenic
985744560 5:1638756-1638778 CCTCCCCTGGAGCCTCTGGAGGG + Intergenic
985820368 5:2156052-2156074 CCTGCCCTGGAGCCGCTGGAGGG - Intergenic
985870146 5:2548053-2548075 CCTCACCAGGAGCATCTCCAGGG - Intergenic
986637387 5:9836483-9836505 CATAACCTGGGGCGTATGGAGGG - Intergenic
986999837 5:13648950-13648972 CCAATCTTGGAGCATCTTGATGG + Intergenic
989270001 5:39521855-39521877 TCTAACATGCAGCATCTAGAAGG - Intergenic
994546917 5:101178347-101178369 CCTGACATGGAGTAGCTGGAGGG + Intergenic
997163130 5:131630442-131630464 CCAAACCTGCAGTATCTGGGAGG + Intronic
997885979 5:137630298-137630320 CCTACACTGGAGGACCTGGAGGG - Intronic
999265980 5:150267145-150267167 CCTACCCTGGAGGATATGAAAGG - Intronic
1000334071 5:160228994-160229016 GCTGACCTGGAGCATGGGGAAGG - Intronic
1000566545 5:162854998-162855020 CCTCACCTGGTTCATCTGTAGGG + Intergenic
1001945639 5:175775315-175775337 CAGGATCTGGAGCATCTGGATGG - Intergenic
1002086677 5:176780294-176780316 CCTCCCCTGGAGCCTCTAGAAGG + Intergenic
1002441993 5:179269197-179269219 TCTCCCCTGGAGCCTCTGGAGGG + Intronic
1003032389 6:2613260-2613282 CCTCACCTGGAGCCTCCAGAAGG - Intergenic
1003878328 6:10457930-10457952 TCTCTCCTGGAGCCTCTGGAGGG - Intergenic
1004279489 6:14268934-14268956 CCTACCCTGGAGCCTTTGGAAGG - Intergenic
1005261572 6:24066739-24066761 TCTACACTGGAGCTTCTGGAGGG + Intergenic
1015603772 6:134935679-134935701 TCTAACCTGGAGCAAAGGGAAGG - Intronic
1016028302 6:139311638-139311660 ACTAAACTGGAGAAACTGGAAGG + Intergenic
1017492698 6:154958392-154958414 CCAAACCTGAGCCATCTGGAGGG + Intronic
1018391286 6:163343632-163343654 CCTTGTCTGGACCATCTGGAAGG + Intergenic
1019255146 7:44895-44917 CATCATCTGTAGCATCTGGAAGG + Intergenic
1022066987 7:26868707-26868729 CCTAACCTGGAAAATCTGTGAGG + Intronic
1023063586 7:36352972-36352994 CCTGACCTGTAGCATCTTGAGGG - Intronic
1023166709 7:37350045-37350067 CCTACACTGGAGGGTCTGGATGG + Intronic
1023914038 7:44575080-44575102 ATTATCCTGGATCATCTGGATGG - Intergenic
1024738804 7:52334028-52334050 TGTAACCTGTAGCATCTTGAGGG + Intergenic
1026138370 7:67683356-67683378 CCTCAGCTGGAGCTTCTGGCTGG - Intergenic
1026511316 7:71029488-71029510 CCTGCCCTAGAGCATCTGGCCGG - Intergenic
1028352636 7:89868054-89868076 CATATCCTGGATTATCTGGATGG + Intergenic
1030791095 7:113730005-113730027 CATAACCTTGAACAACTGGAGGG - Intergenic
1032168380 7:129563694-129563716 ACTATCCTGGATTATCTGGATGG - Intergenic
1033929955 7:146508697-146508719 CTTGAGCTGGAGCATCTGGGTGG + Intronic
1035530825 8:349767-349789 CCGAGCCTGGAGGATGTGGACGG - Intergenic
1035734875 8:1880946-1880968 CCTCACATGCAGCATCTGGCTGG + Intronic
1036984714 8:13515700-13515722 CCCAACCTGGAGCAGCTAGGAGG - Intergenic
1037642255 8:20756694-20756716 GCTAACCTGGATTATCTGGATGG - Intergenic
1038415448 8:27391619-27391641 TACAACCTGGTGCATCTGGAGGG + Intronic
1045031524 8:98141265-98141287 TCGAACCTGGATCATCTGTATGG - Intronic
1049149472 8:141025318-141025340 TCTTGCCTGGAGCCTCTGGAAGG - Intergenic
1049156348 8:141069164-141069186 ATTACCCTGGAGTATCTGGATGG - Intergenic
1049264491 8:141660195-141660217 CCTAACTTGGACAATCTGGCTGG + Intergenic
1051753798 9:20373005-20373027 CCTAACCTGCAGTGTCTCGAAGG + Intronic
1051877353 9:21806451-21806473 CCTAACCAGCAGTATCTGGGAGG - Intronic
1055028238 9:71745053-71745075 CCGTTCCTGGATCATCTGGATGG + Exonic
1055574898 9:77650958-77650980 CCTTATCTGTAGAATCTGGAAGG + Intergenic
1056284196 9:85071351-85071373 ACTAACCTGGATTATCTGGGTGG + Intergenic
1059357976 9:113715963-113715985 CCTAACCAGGGGCACCTGCATGG + Intergenic
1060045048 9:120333214-120333236 CCTAACCTGCAGCAGCAGGGGGG + Intergenic
1062104441 9:134745819-134745841 CCTCACCTGGAGCCTCCAGAGGG - Intronic
1062151269 9:135020404-135020426 CCTCCCCTAGAGCTTCTGGAGGG + Intergenic
1062158623 9:135067650-135067672 CCTCCCCTAGAGCCTCTGGAGGG + Intergenic
1062445536 9:136592598-136592620 CCTCCCCTGGAGCCTCTGGAGGG + Intergenic
1062624697 9:137437460-137437482 CCTAACCCAGAGCCTCTGGAGGG + Intronic
1185650474 X:1644141-1644163 CCTCCCCTAGAGCCTCTGGAGGG + Intergenic
1185653675 X:1667407-1667429 CCTCCCCTAGAGCCTCTGGAGGG - Intergenic
1185677088 X:1857897-1857919 CCTCCCCTAGAGCTTCTGGAGGG - Intergenic
1185698877 X:2215402-2215424 CCTCTCCTAGAGCCTCTGGAGGG + Intergenic
1185698927 X:2215741-2215763 CCTCTCCTAGAGCCTCTGGATGG + Intergenic
1185699076 X:2216727-2216749 CCTCTCCTAGAGCCTCTGGATGG + Intergenic
1185699175 X:2217422-2217444 CCTCTCCTCGAGCCTCTGGATGG + Intergenic
1185704945 X:2260021-2260043 CCTCCCCTAGAGCCTCTGGAGGG - Intronic
1185710317 X:2298203-2298225 CCTCCCCTAGAGCGTCTGGATGG + Intronic
1185822725 X:3220385-3220407 CCTCACCTAGAGCCTCTGGAGGG - Intergenic
1187704226 X:21993632-21993654 CCTCACATGGAGGATCTAGAGGG - Intronic
1187948102 X:24446134-24446156 ACTAACCTGGATTATCTGGATGG + Intergenic
1191755547 X:64588568-64588590 ACCATCCTGGACCATCTGGATGG - Intergenic
1192498462 X:71632536-71632558 ACTATCCTGGATTATCTGGATGG - Intergenic
1193006071 X:76619112-76619134 CCTAACCAGGATGAACTGGATGG + Intergenic
1195177609 X:102326307-102326329 CCTCACCTGGAGCATAGTGAAGG - Exonic
1195181255 X:102360786-102360808 CCTCACCTGGAGCATAGTGAAGG + Exonic
1195763016 X:108267267-108267289 ATTATCCTGGATCATCTGGATGG - Intronic
1200050980 X:153431598-153431620 CCTCCCCTAGAGCCTCTGGAGGG + Intergenic
1200136528 X:153877762-153877784 CCTAACCTGGAGCATCTGGAAGG - Intronic
1200389362 X:155928428-155928450 CCTCTCCTAGAGCCTCTGGAAGG - Intronic
1200882253 Y:8228570-8228592 CCTAACTTGGTGCACCTGAAGGG - Intergenic
1202194079 Y:22278000-22278022 CCTAACATAGAGCACCTGAAGGG - Intergenic