ID: 1200136901

View in Genome Browser
Species Human (GRCh38)
Location X:153879660-153879682
Sequence CCCTGCCCACTTGTGGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200136894_1200136901 0 Left 1200136894 X:153879637-153879659 CCCCACGCAACAGAGCATCAAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1200136901 X:153879660-153879682 CCCTGCCCACTTGTGGCACTGGG 0: 1
1: 0
2: 1
3: 12
4: 204
1200136892_1200136901 18 Left 1200136892 X:153879619-153879641 CCGGAGGGGCCTACAAAGCCCCA 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1200136901 X:153879660-153879682 CCCTGCCCACTTGTGGCACTGGG 0: 1
1: 0
2: 1
3: 12
4: 204
1200136897_1200136901 -2 Left 1200136897 X:153879639-153879661 CCACGCAACAGAGCATCAAGGCC 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1200136901 X:153879660-153879682 CCCTGCCCACTTGTGGCACTGGG 0: 1
1: 0
2: 1
3: 12
4: 204
1200136896_1200136901 -1 Left 1200136896 X:153879638-153879660 CCCACGCAACAGAGCATCAAGGC 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1200136901 X:153879660-153879682 CCCTGCCCACTTGTGGCACTGGG 0: 1
1: 0
2: 1
3: 12
4: 204
1200136893_1200136901 9 Left 1200136893 X:153879628-153879650 CCTACAAAGCCCCACGCAACAGA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 1200136901 X:153879660-153879682 CCCTGCCCACTTGTGGCACTGGG 0: 1
1: 0
2: 1
3: 12
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200136901 Original CRISPR CCCTGCCCACTTGTGGCACT GGG Intronic
900390289 1:2430911-2430933 CTCTGCCCACCTGCTGCACTGGG + Intronic
901926791 1:12571136-12571158 CCATGGTCACTTGTGGCACCAGG + Intronic
902926326 1:19698181-19698203 CCCTGCCCACAGGTGGCTCGAGG - Intronic
903221126 1:21870236-21870258 CCCTGCCCTCTGGGGGCTCTGGG + Intronic
907860893 1:58352000-58352022 CACTGGCCACTTCTGCCACTGGG + Intronic
908544427 1:65148977-65148999 CGCCGCCCACCTGTGGCAGTCGG + Intronic
908678506 1:66632825-66632847 CCCTTCCCACATGTGGCTTTGGG + Intronic
909042121 1:70667107-70667129 CCCTGCCATCTTGTCTCACTTGG + Intergenic
913418425 1:118637418-118637440 CCTGGCCCACTTTTGTCACTGGG + Intergenic
915100293 1:153494548-153494570 CCATGCCCCTTAGTGGCACTTGG - Intergenic
915298900 1:154941070-154941092 CGCTGCCCACCTGTGGGCCTTGG - Intergenic
917930837 1:179821492-179821514 CCCTGCCCACTTCTGGTAGTAGG - Intergenic
919767181 1:201135056-201135078 CCCTGTGCACTTCTCGCACTGGG - Exonic
920134040 1:203755186-203755208 CCCGGCCCAATTTTGGCATTTGG + Intergenic
920498232 1:206470493-206470515 CCCTGCCTCCTTGTGGCGGTGGG - Exonic
922605613 1:226888200-226888222 CCATGTCCACTTGTGCCACATGG - Intronic
923206773 1:231766869-231766891 CCCTGACCACATGTGACACATGG - Intronic
923470520 1:234286414-234286436 CCTTTCCCACCTGTGGCATTCGG - Intronic
923679933 1:236111109-236111131 CCTTGCCCACTTCTGCCACAGGG - Intergenic
923704316 1:236331582-236331604 CCTTGCCCTCTTGTGCCACATGG + Intergenic
923826984 1:237511340-237511362 CCCTGCCCACTTGTCTAATTAGG - Intronic
1062875586 10:940556-940578 TCATGCCCACTTCAGGCACTGGG - Intergenic
1063412192 10:5845145-5845167 CCCTGACCACTCCTGTCACTTGG + Intergenic
1064172805 10:13048990-13049012 CCCTCTCCAGTTGTGACACTTGG - Intronic
1064207750 10:13338513-13338535 CCCTGCCCACACTTGGCACTGGG - Intronic
1065385732 10:25131400-25131422 CCCTCCCCACTTTTGGCAGAGGG - Intergenic
1066302287 10:34107731-34107753 CCCAGGCCACATGTGGCCCTTGG + Intergenic
1066500271 10:35986731-35986753 GCCTGCCCCATTGTGGCACCTGG - Intergenic
1067832202 10:49616711-49616733 CCCTGCCCTCTACTGGCACAAGG + Intronic
1069070587 10:63987398-63987420 TCCAGCCCCCTTGTGGCAGTTGG + Intergenic
1073352967 10:102832784-102832806 CCCTTCCCAGTAGTGGCTCTGGG + Intronic
1074547199 10:114410121-114410143 CCCTGCCCACCTGTGGCCTTGGG - Intergenic
1075005542 10:118827376-118827398 CCAAGGCCACATGTGGCACTGGG + Intergenic
1075502640 10:122989713-122989735 CACTGCCCACGTGTGGCTATTGG + Intronic
1075822795 10:125329105-125329127 CCCTCCTCATTTGTGGAACTGGG + Intergenic
1075830895 10:125409828-125409850 CCCTGCTCACTGCTGGCACGTGG + Intergenic
1075875470 10:125802562-125802584 CTCTGGCCACTTGTGCCACATGG - Intronic
1076113521 10:127879601-127879623 CCCAGCCCACTTCCAGCACTAGG - Intronic
1076116613 10:127906000-127906022 CCCTGCCCATTTCTGTCCCTGGG - Intergenic
1077509400 11:2948459-2948481 ACCTGTTCACTCGTGGCACTCGG - Intronic
1078151835 11:8766213-8766235 TCCTGCCCACTTCTGGGGCTGGG - Intronic
1083000578 11:59287450-59287472 CCCTGGCCATCTGTGGCACCCGG - Intergenic
1083633805 11:64109418-64109440 CTCTCCCCACTCGTGACACTGGG + Intronic
1089378872 11:118013560-118013582 CCCCACCCGCTTCTGGCACTGGG - Intergenic
1092920098 12:13223487-13223509 CCCTGCCCTCTTGTAGCTCATGG - Intergenic
1092945559 12:13450881-13450903 CACTGCCCATTTGTGCCCCTGGG + Intergenic
1098377229 12:69829889-69829911 ACCTGCCCAGTGCTGGCACTGGG + Intronic
1104903714 12:132202712-132202734 CCCTGGCCACTGCAGGCACTGGG - Intronic
1105487753 13:20853825-20853847 CACTGGCCACTTGTGGCAGTTGG - Intronic
1106257045 13:28031469-28031491 CCCTGCCCTCATGAGGCACAGGG + Intronic
1107600927 13:42011889-42011911 CACTGCCCACATCTGGCTCTGGG + Intergenic
1113508756 13:110834844-110834866 CTCTGCCCCTGTGTGGCACTTGG + Intergenic
1113946985 13:114049959-114049981 CCATGCCCACCTCTGGGACTGGG - Intronic
1117834434 14:59787654-59787676 TTCTGCCCACTTTTGGCACAAGG - Intronic
1119849630 14:77857962-77857984 CCCTGCCCAGTTGAGGGCCTTGG - Intronic
1120796509 14:88639132-88639154 CCCAACTCTCTTGTGGCACTTGG - Intronic
1122286340 14:100654956-100654978 CTCTGCCCCCTTGTGGCCCGAGG + Intergenic
1124591871 15:31060991-31061013 CCCTGCCCCCTCATGGCACCAGG + Intronic
1126176489 15:45740582-45740604 GCCTGCCCACTTGTCTCACAGGG - Intergenic
1126356521 15:47801999-47802021 GCCTGCCTACTTGTGGCAGTGGG - Intergenic
1126685593 15:51246440-51246462 CTCTGGCCACTTGATGCACTAGG + Intronic
1126969126 15:54089872-54089894 CCCTGCTGACTTGTGGGAGTGGG + Intronic
1129324975 15:74795016-74795038 CCCTGCCCATCTGGGGCTCTAGG - Intronic
1130907269 15:88249527-88249549 CCCTGCCCACTCTGGGCCCTTGG + Intronic
1131063294 15:89417492-89417514 CCCTGCCCACTCCTGGCCCGCGG + Intergenic
1131259959 15:90883059-90883081 ACCTGCCCACCTCTGGCACTTGG - Exonic
1132013714 15:98298065-98298087 CACTGCTCCCTTGTTGCACTTGG + Intergenic
1132350845 15:101138910-101138932 CCCTGCCTGCCTGTGGGACTAGG - Intergenic
1133897463 16:9943180-9943202 CTCTGACCACCTCTGGCACTCGG + Intronic
1134904987 16:17972381-17972403 CTCTGCTCACTTGGGGCTCTTGG + Intergenic
1135565054 16:23505644-23505666 CCCTCCCCACCTTTGGCTCTGGG + Intronic
1136683805 16:31982652-31982674 CCCTGCCCACCTGTGGCCAAAGG - Intergenic
1136784433 16:32926208-32926230 CCCTGCCCACCTGTGGCCAAAGG - Intergenic
1136885350 16:33927598-33927620 CCCTGCCCACCTGTGGCCAAAGG + Intergenic
1138303448 16:55952926-55952948 CCTTGCCCACTTTTGGTATTTGG - Intronic
1138537214 16:57666566-57666588 CCCTGCCCACTGGAGCCATTGGG + Intergenic
1138831595 16:60381436-60381458 CCCTGCCCTCTTCTGTCAGTAGG - Intergenic
1139346133 16:66305113-66305135 CCCTGGCAATTTGTGGCACCTGG - Intergenic
1140423875 16:74843913-74843935 CTCTGGCCACTTCTGGCCCTGGG - Intergenic
1141254297 16:82386423-82386445 CTCTCCCCACTGGTGGCTCTGGG + Intergenic
1142268033 16:89073693-89073715 CCACACCCACGTGTGGCACTTGG + Intergenic
1203087092 16_KI270728v1_random:1190214-1190236 CCCTGCCCACCTGTGGCCAAAGG - Intergenic
1142710525 17:1720964-1720986 CCCTGCCCTCTAGCGGTACTGGG - Intronic
1143633008 17:8149472-8149494 GCCTGCCCACCTGGGGCACAGGG - Exonic
1144061045 17:11583519-11583541 CCCTGAGCACTTGGGCCACTGGG - Intergenic
1146603309 17:34236649-34236671 TCCTGCCCAGCTGTGGCTCTTGG - Intergenic
1147144727 17:38478359-38478381 CCCTGCCCACCTGTGGCCAAAGG - Intronic
1147575517 17:41596672-41596694 CCATGCCCTCTTTTGGAACTGGG - Intergenic
1147722608 17:42548165-42548187 CCCTGCCCACTTGCGGCTCTCGG + Intergenic
1152756690 17:82089996-82090018 TCCTGCCCACATGTGGCCCATGG + Intronic
1153009553 18:525650-525672 CCCTGATCACTTGTGGTGCTTGG - Intergenic
1155356611 18:24959691-24959713 CCCTGCCCTCTTGGAGCATTAGG - Intergenic
1157189468 18:45568447-45568469 CCCTCCCCATTTGAGGCACATGG + Intronic
1160427865 18:78790673-78790695 CCCGGCGGACTTGTGGCACAGGG - Intergenic
1160663782 19:313404-313426 CCCTGGCCCCTGGAGGCACTGGG + Intronic
1161227934 19:3155973-3155995 CCCTGCCCACTTGTTGGCCCAGG + Intronic
1162386863 19:10365174-10365196 CCCATCCCACCTGTGACACTGGG - Intronic
1162444298 19:10712855-10712877 TCCTGCCTACTTTTGGCACGTGG - Exonic
1162808015 19:13148988-13149010 CCCTGCCCACCTGAGCCCCTGGG - Intronic
1163586707 19:18168335-18168357 CTCTGCCCTCTTGTGGCAACCGG + Intronic
1163636972 19:18441492-18441514 CCATCCCCACTAGTGGCACAGGG + Intergenic
1163729588 19:18941304-18941326 CCCTGCCGGCTTTTTGCACTGGG + Intergenic
1164781276 19:30895603-30895625 CTCTGCCCACATCTGACACTTGG - Intergenic
1165141197 19:33700943-33700965 CCCTGCCTATTTCTGGCACTTGG - Intronic
1166991236 19:46693973-46693995 CCCTGCCCACTTGGCCCACCCGG + Exonic
1167292700 19:48633272-48633294 CCCTGCCCCCTTGTGCCCCGTGG + Intronic
1168267726 19:55231560-55231582 CCCTGCCCACCCGCGGCCCTGGG - Intronic
1168422359 19:56212904-56212926 CTCTGGGCACATGTGGCACTGGG + Intergenic
1168456257 19:56511048-56511070 CCCTGGCCTCTGGTGGCATTTGG + Intronic
929898732 2:45983585-45983607 CCCTGCCATCCTGTGACACTGGG + Intronic
929911379 2:46092415-46092437 CTCTGCCCAATTCTGGCACCGGG - Intronic
932181043 2:69646134-69646156 CCTAGACCACTTGTGTCACTGGG + Intronic
934528424 2:95068132-95068154 CTCTGTCCACTTGTAGCTCTCGG + Intergenic
934860763 2:97762071-97762093 CCCTGCCCCTTTGTGGCCCGGGG - Exonic
935489512 2:103698954-103698976 CCCTCCCCGTTTGTGTCACTGGG + Intergenic
936508886 2:113129905-113129927 CCCTTCCCAGCTGTGGCCCTGGG - Intronic
937291240 2:120783352-120783374 CCAAGCCCACCTGTGGCACCTGG + Intronic
937350076 2:121155161-121155183 CCAAGCCCACTTCTAGCACTGGG + Intergenic
938661331 2:133490063-133490085 CCCTGACCATTTGTAGAACTGGG - Intronic
938954508 2:136285445-136285467 CCCTCCCCTCTAGTGGTACTTGG + Intergenic
940831747 2:158474406-158474428 CCCTGCCCACTCCTAGCATTGGG + Intronic
941986411 2:171515806-171515828 CCCTGCCCACGTGGGGCAGGTGG + Intergenic
947636523 2:231683275-231683297 CCCTGACCATTTTTGGCCCTGGG - Intergenic
948264676 2:236628016-236628038 CCCAGCCCACCTGGGGCAGTGGG + Intergenic
948920320 2:241063310-241063332 CCGTGCCCAGTCGTGGCCCTGGG + Intronic
949006963 2:241655204-241655226 CCCTGACCTCTGGTGGCACGTGG - Intronic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1172884714 20:38223320-38223342 CCCTGCCCTCTTGGGGCTCGTGG - Intronic
1173016914 20:39234230-39234252 ACCTGCCCACACCTGGCACTTGG - Intergenic
1173430245 20:42981513-42981535 GCTTGCCCTCTTGTTGCACTTGG + Intronic
1173525170 20:43726786-43726808 CTCTGCCCAGTTTTGGCCCTTGG + Exonic
1174955303 20:55091213-55091235 CCCTGCCAACTATTGGAACTTGG - Intergenic
1175806335 20:61831193-61831215 CCCTGACCACATCTGGCACTGGG + Intronic
1175928362 20:62481656-62481678 CCCTGCCCAGCTGTGGCCCGGGG - Intergenic
1178386068 21:32151603-32151625 CCCTGACCAATAGTGGCCCTGGG + Intergenic
1180061997 21:45390393-45390415 CCCTGCCCACCTGTGCCCCCCGG + Intergenic
1180579068 22:16812222-16812244 CCCTGCCCCTTTATGTCACTGGG + Intronic
1180908268 22:19431175-19431197 CGCTGCCCACCTGTGGTCCTTGG - Intronic
1182972351 22:34590185-34590207 CCTTGCCCACTTCTGCCACAGGG + Intergenic
1183667097 22:39252444-39252466 CCCTTCCCCCTTGGGGCACCAGG + Intergenic
1183977336 22:41520215-41520237 CCTTGCCCACTTCTGCCACAGGG - Exonic
1184660782 22:45964623-45964645 CCCTTCCCACCTGTGCCACTAGG + Intronic
1185416541 22:50713581-50713603 CCCTGTCACCTGGTGGCACTGGG + Intergenic
952573472 3:34745593-34745615 CCATGCCCATCTGTGGCAATAGG - Intergenic
952872071 3:37909769-37909791 CCCTCCCCAAATGTGGGACTTGG - Intronic
953789458 3:45936402-45936424 CCCTCCCCAGGTGTGGCATTGGG - Intronic
953914008 3:46906511-46906533 GCCTGCCCACTCCAGGCACTTGG - Intergenic
954305945 3:49725438-49725460 ACCTGCCCACCAGTGGCACCAGG + Exonic
956344105 3:68259010-68259032 CCCTGCCCACGTGTGCCTTTGGG - Intronic
958093761 3:88912836-88912858 CCCAGCCCAAATGTGACACTTGG + Intergenic
958591848 3:96169309-96169331 CCCTGCCCACTTGGCCCACCAGG - Intergenic
959496361 3:107057221-107057243 CCCTTCCCAGTTGTGTGACTTGG - Intergenic
962479415 3:135785740-135785762 CCCTGCCCACTTAAGGCAGCTGG + Intergenic
962873351 3:139517345-139517367 CTCTGCCCATGGGTGGCACTAGG + Intergenic
964408987 3:156378912-156378934 CCATGCCAGCTTGAGGCACTGGG - Intronic
966100823 3:176267445-176267467 CCCTGTACACCTGTGGCACCTGG - Intergenic
968919334 4:3514596-3514618 CCCCACACACTTGTGGCCCTGGG + Intronic
969267072 4:6071504-6071526 CCCTGCTCACTCCTGGCGCTGGG + Intronic
970598225 4:17619119-17619141 CCCTGCCCACTTCCTGCAGTGGG + Intronic
971192546 4:24441363-24441385 CCCTGCCCCCTTGTGCCCGTGGG + Intergenic
973912109 4:55592018-55592040 CCCTCCCCATTTGTGTCCCTTGG + Intronic
976212802 4:82688674-82688696 CCTTGCCTTCATGTGGCACTTGG + Intronic
977334579 4:95680418-95680440 CACTGTCAACTTGTGGCATTTGG + Intergenic
977809765 4:101346245-101346267 CCCTGCCCAAGTGAGGCAGTCGG + Intronic
988709164 5:33756212-33756234 CCATGGCCTCTGGTGGCACTGGG + Intronic
997965641 5:138353417-138353439 CCCGCCCCACTTGGGGCTCTGGG - Intronic
999256400 5:150212053-150212075 CCCTGCCCACTCCTGCCACCGGG + Intronic
1001232802 5:170003916-170003938 CCCTGCCCAGTTTTGGCCATGGG - Intronic
1002938649 6:1697117-1697139 ACATGCCCACTTATGGCATTTGG - Intronic
1003565466 6:7218570-7218592 CCCTGCCCATTTTAGGTACTAGG + Intronic
1005093096 6:22079990-22080012 CCGTGGCCACATGTGGCTCTTGG + Intergenic
1010897498 6:81382374-81382396 CTCTGCACCCATGTGGCACTAGG + Intergenic
1011384865 6:86784691-86784713 CCTTCCCCACTTGCTGCACTTGG - Intergenic
1012860708 6:104555986-104556008 CACTGCCAACTTCTGGCTCTTGG + Intergenic
1014540957 6:122675919-122675941 CCCTGACCATTTTTGGCACCAGG + Intronic
1021983311 7:26075875-26075897 ACCTGTCCACATGTGGCAGTTGG + Intergenic
1024557805 7:50618431-50618453 CGCTGTGCACTTGTGCCACTGGG - Intronic
1024699054 7:51887283-51887305 CTCTGCCCACTGGGGCCACTGGG + Intergenic
1025111766 7:56223107-56223129 CCATGCCCGCTTGTGACACGGGG + Intergenic
1026982671 7:74535939-74535961 CTCTGGCCACCTCTGGCACTAGG + Intronic
1031380761 7:121083335-121083357 CCCCTCCCACATGGGGCACTTGG + Intronic
1032985763 7:137335325-137335347 CCCTGGCCAGATGTTGCACTTGG - Intronic
1035156883 7:156921417-156921439 CCCGGCCCACTGGGAGCACTGGG + Intergenic
1036214845 8:6870675-6870697 CCCAGCTCACTTGCAGCACTTGG + Exonic
1036960354 8:13238723-13238745 TCCTGCCCAGCTGTGGCCCTGGG + Intronic
1040379269 8:46856511-46856533 CCCTGCCTACTGGTGACATTGGG + Intergenic
1041190479 8:55348555-55348577 CCATGTCCACTTCTGACACTGGG - Intronic
1044836185 8:96297823-96297845 CCCTGCCCTCTTGAGGCACAAGG - Intronic
1046459792 8:114518361-114518383 CCCTGCACTCTTGGGGGACTGGG - Intergenic
1049223033 8:141436536-141436558 AGCTGCCCGCTTGTGGCCCTCGG - Intergenic
1049786802 8:144454770-144454792 CCCTGCACACGTGGGGCCCTGGG + Intronic
1053132031 9:35621031-35621053 CCTTCCCCACGTGTGTCACTTGG + Intronic
1053164814 9:35836838-35836860 CCGTGCCCACGAGTGGCAGTGGG + Intronic
1054815034 9:69466513-69466535 CCCTGCACTCTGGTGGCACTCGG + Intronic
1060068673 9:120527356-120527378 CACTACCCACATGTGGCTCTTGG + Intronic
1060593264 9:124832810-124832832 CCCTGCCCCATTGTGGCCCTTGG + Intergenic
1060882186 9:127124999-127125021 CCCGCCCCACTGGTGGCATTGGG + Intronic
1061014435 9:127973735-127973757 CCCTGCCCACTTCTGCCAGCAGG + Intronic
1061193108 9:129093725-129093747 TCCTGTCCCCTTGGGGCACTGGG + Intergenic
1061713480 9:132503628-132503650 TCCTGCCCACCTCTGGCACAAGG - Intronic
1189246925 X:39570484-39570506 CCCTTCCAACTTGTGGTTCTGGG - Intergenic
1189297218 X:39927399-39927421 CTCTGCTCACATGTGGGACTTGG - Intergenic
1191745704 X:64484297-64484319 CCCTGACCACTTGTGCTTCTCGG + Intergenic
1191839547 X:65501921-65501943 CCCTGGCCAAGTGTGGCACAGGG + Exonic
1193509768 X:82384497-82384519 ACTTGCCCATTTGTGCCACTGGG - Intergenic
1199353460 X:146832208-146832230 CCCTGCCCACCTGACCCACTGGG - Intergenic
1199965965 X:152821252-152821274 CACAGCCCTCTTGGGGCACTAGG + Intergenic
1200136901 X:153879660-153879682 CCCTGCCCACTTGTGGCACTGGG + Intronic
1200844679 Y:7819594-7819616 CCCTGCCTACTGGGGACACTGGG - Intergenic
1200859903 Y:7979658-7979680 CCCTGCCTACTTGGGACATTGGG - Intergenic
1200864762 Y:8031631-8031653 CACTGCCTATTTGTGGCATTGGG + Intergenic
1200892554 Y:8339385-8339407 CCCTGCCTATTGGGGGCACTGGG + Intergenic
1202259358 Y:22953966-22953988 CCCTGCCTACTTGAGACATTGGG + Intergenic
1202262521 Y:22984383-22984405 CCCTGCCTACTGGTGACATTCGG + Intronic
1202412344 Y:24587710-24587732 CCCTGCCTACTTGAGACATTGGG + Intergenic
1202415511 Y:24618124-24618146 CCCTGCCTACTGGTGACATTCGG + Intronic
1202455276 Y:25051962-25051984 CCCTGCCTACTGGTGACATTCGG - Intronic
1202458436 Y:25082360-25082382 CCCTGCCTACTTGAGACATTGGG - Intergenic