ID: 1200137019

View in Genome Browser
Species Human (GRCh38)
Location X:153880101-153880123
Sequence CTACACCCGCAGGTCCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 123}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200137005_1200137019 4 Left 1200137005 X:153880074-153880096 CCCCATCCCACCCCACCTGGCCT 0: 1
1: 0
2: 7
3: 120
4: 941
Right 1200137019 X:153880101-153880123 CTACACCCGCAGGTCCCTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 123
1200137006_1200137019 3 Left 1200137006 X:153880075-153880097 CCCATCCCACCCCACCTGGCCTC 0: 1
1: 2
2: 4
3: 113
4: 1029
Right 1200137019 X:153880101-153880123 CTACACCCGCAGGTCCCTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 123
1200137012_1200137019 -8 Left 1200137012 X:153880086-153880108 CCACCTGGCCTCCCACTACACCC 0: 1
1: 0
2: 3
3: 42
4: 477
Right 1200137019 X:153880101-153880123 CTACACCCGCAGGTCCCTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 123
1200137010_1200137019 -6 Left 1200137010 X:153880084-153880106 CCCCACCTGGCCTCCCACTACAC 0: 1
1: 0
2: 9
3: 61
4: 675
Right 1200137019 X:153880101-153880123 CTACACCCGCAGGTCCCTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 123
1200137009_1200137019 -3 Left 1200137009 X:153880081-153880103 CCACCCCACCTGGCCTCCCACTA 0: 1
1: 1
2: 23
3: 202
4: 1869
Right 1200137019 X:153880101-153880123 CTACACCCGCAGGTCCCTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 123
1200137001_1200137019 19 Left 1200137001 X:153880059-153880081 CCCAGAAGAGCCTTGCCCCATCC 0: 1
1: 0
2: 0
3: 18
4: 175
Right 1200137019 X:153880101-153880123 CTACACCCGCAGGTCCCTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 123
1200137008_1200137019 -2 Left 1200137008 X:153880080-153880102 CCCACCCCACCTGGCCTCCCACT 0: 1
1: 1
2: 11
3: 90
4: 890
Right 1200137019 X:153880101-153880123 CTACACCCGCAGGTCCCTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 123
1200137011_1200137019 -7 Left 1200137011 X:153880085-153880107 CCCACCTGGCCTCCCACTACACC 0: 1
1: 0
2: 2
3: 38
4: 399
Right 1200137019 X:153880101-153880123 CTACACCCGCAGGTCCCTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 123
1200137003_1200137019 9 Left 1200137003 X:153880069-153880091 CCTTGCCCCATCCCACCCCACCT 0: 1
1: 3
2: 32
3: 288
4: 1819
Right 1200137019 X:153880101-153880123 CTACACCCGCAGGTCCCTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 123
1200137002_1200137019 18 Left 1200137002 X:153880060-153880082 CCAGAAGAGCCTTGCCCCATCCC 0: 1
1: 0
2: 1
3: 18
4: 212
Right 1200137019 X:153880101-153880123 CTACACCCGCAGGTCCCTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 123
1200137007_1200137019 2 Left 1200137007 X:153880076-153880098 CCATCCCACCCCACCTGGCCTCC 0: 1
1: 1
2: 23
3: 163
4: 1287
Right 1200137019 X:153880101-153880123 CTACACCCGCAGGTCCCTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 123
1200137000_1200137019 20 Left 1200137000 X:153880058-153880080 CCCCAGAAGAGCCTTGCCCCATC 0: 1
1: 0
2: 0
3: 23
4: 188
Right 1200137019 X:153880101-153880123 CTACACCCGCAGGTCCCTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200137019 Original CRISPR CTACACCCGCAGGTCCCTCA GGG Intronic
900340464 1:2186345-2186367 CTACACACTCAGGTTTCTCAGGG + Intronic
900788006 1:4661375-4661397 CTCCACCCTCATGTTCCTCAGGG + Intronic
902336868 1:15758975-15758997 CCCCACCCGCAGGCCCCTCCAGG - Intronic
905462749 1:38132256-38132278 CTAGTCCCGTAGGTCCCTCAAGG + Intergenic
907287982 1:53394234-53394256 CTACCACCTCAAGTCCCTCAGGG - Intergenic
912113473 1:106372769-106372791 CTACAGGAGCAGATCCCTCATGG - Intergenic
912485566 1:110024832-110024854 CTACATCCCCAGTTCCCACAAGG - Intergenic
915315519 1:155026518-155026540 CTACACCCTGAGGTCCCTGGGGG - Intronic
916483248 1:165234493-165234515 CCAGACCCCCAGGTTCCTCAGGG - Intronic
919847320 1:201650068-201650090 CTACACCCGCAGGTCTTTTAGGG + Intronic
921000597 1:211039326-211039348 CTACAGGGGCAGGGCCCTCATGG + Intronic
1071991502 10:91104613-91104635 CCACACTCGCAGGTACCACATGG + Intergenic
1072003605 10:91220950-91220972 CTGCACCCGAAGGGCCCTCCCGG - Intronic
1072407755 10:95170528-95170550 CCTCACAGGCAGGTCCCTCATGG + Intergenic
1073212916 10:101819049-101819071 CCACACACGCAGTTCCCACAAGG + Intergenic
1076606054 10:131690816-131690838 CTACAGCCTCCGGGCCCTCATGG - Intergenic
1076695760 10:132246609-132246631 CCACACCTGCAAGTCCCTCCGGG + Intronic
1076725036 10:132409279-132409301 CTACACCCACAGGGACCCCATGG + Intronic
1077065753 11:640280-640302 CACCACCGGCAGGACCCTCATGG - Exonic
1078536864 11:12182302-12182324 CTACACTGGCAGGCCCCACATGG - Intronic
1079656097 11:22988123-22988145 CTACAGGGGCAGGGCCCTCATGG - Intergenic
1083887263 11:65578979-65579001 CTCCTCCCCCAGCTCCCTCAGGG - Intronic
1084660713 11:70544855-70544877 CCCCACCCACAGGTCCTTCAGGG + Intronic
1085232153 11:74981537-74981559 CTACACCCCCAAGTGCCACAGGG - Intergenic
1086439781 11:86816557-86816579 CTCCACCCCCAGTTCCCTGATGG + Intronic
1087246938 11:95850481-95850503 CTACAGCAGCAGGTCTTTCATGG - Intronic
1088535732 11:110858778-110858800 CTACACACCCAGGTTACTCATGG + Intergenic
1095152308 12:38809821-38809843 TTACAGCCACAGGTCCCTGATGG - Intronic
1095382826 12:41615666-41615688 CTACACGGGCAGGGCCCTCATGG + Intergenic
1099105057 12:78486637-78486659 CTACACAGGCAGGTCCCTCATGG - Intergenic
1101351115 12:103930514-103930536 CAGCACCCACAGGGCCCTCATGG - Exonic
1102225535 12:111225620-111225642 CTGCACCCCCAGACCCCTCAAGG - Intronic
1104543097 12:129685540-129685562 CTACAGGGGCAGGGCCCTCATGG + Intronic
1105621996 13:22076865-22076887 CTGCAGACGCAGGTCCCTCCAGG - Intergenic
1105900185 13:24746484-24746506 CAACGCCCGCCGGCCCCTCAAGG - Intergenic
1109857819 13:68156314-68156336 CTGCACAGGCAGGGCCCTCATGG - Intergenic
1113518045 13:110918277-110918299 CTCCAACCCCACGTCCCTCAGGG - Intergenic
1115346429 14:32347994-32348016 CTACACACAAATGTCCCTCAGGG - Intronic
1116528337 14:45934946-45934968 CTGCAGCAGCAGGGCCCTCATGG + Intergenic
1117545737 14:56794060-56794082 CCACCCCCGCAAGTCCTTCATGG - Intergenic
1118721789 14:68599695-68599717 CAACACCAGCATGTCACTCATGG - Intronic
1122136572 14:99636259-99636281 CTCCACCCCCAGGTCTCTCCAGG - Intergenic
1127401366 15:58589545-58589567 CTAGACCCTCAGCTCCCTGAAGG + Exonic
1128803057 15:70509333-70509355 CCACACCTGCAGGCCACTCAAGG - Intergenic
1130520396 15:84657257-84657279 CTGCAGTCGCTGGTCCCTCAGGG + Exonic
1136247809 16:28985369-28985391 CTGCACCCCTAGGCCCCTCAAGG - Exonic
1137738158 16:50740475-50740497 CTACATCCACTGGTCCCTTAAGG - Intergenic
1142050658 16:87956009-87956031 CTACTCCCTCACCTCCCTCAAGG - Intronic
1142182594 16:88678486-88678508 CTTCTCCCGCATGTCCCTCCTGG - Exonic
1143007469 17:3846194-3846216 CGACACCCGCAGGCCCCGTACGG + Exonic
1144628947 17:16860465-16860487 CTACAGAAGCAGGTCCCTCGGGG - Intergenic
1144652463 17:17015650-17015672 CTACAGAAGCAGGTCCCTCGGGG + Intergenic
1154504343 18:15020698-15020720 CTACAGGGGCAGGGCCCTCATGG - Intergenic
1156651124 18:39228192-39228214 CTACACGGGCAGGGCCCTCATGG + Intergenic
1157492902 18:48136593-48136615 GTACACCCGCAACTCCCTCTCGG + Intronic
1160195791 18:76754060-76754082 CTCCACCCACAGGTGCCCCAAGG - Intergenic
1160395452 18:78567664-78567686 CTCGTCCCGCAGGTCCCTGACGG - Intergenic
1161713755 19:5864138-5864160 CTCCACCACCAGGTCCCCCATGG + Intergenic
1161716200 19:5877398-5877420 CTGCACCACCAGGTCCCCCATGG + Intronic
1162329204 19:10017066-10017088 CTTCTTCCCCAGGTCCCTCATGG - Exonic
1165727373 19:38122598-38122620 CTAAACCCTCAGGTCACTCTAGG + Intronic
1167504391 19:49863378-49863400 CTGCTCCAGCAGGGCCCTCACGG - Intronic
1168337216 19:55603419-55603441 CTACATCCGCGGGTTCCGCAGGG - Intergenic
925810505 2:7695384-7695406 CAACACCCACAGGACACTCATGG + Intergenic
926144421 2:10388013-10388035 CTGCACTCGCAGGCCCCCCATGG + Intronic
927885470 2:26715675-26715697 CTACACCCTCCCGGCCCTCAGGG - Intronic
937580693 2:123484101-123484123 CTACATCTTCAGATCCCTCACGG + Intergenic
938503532 2:131850904-131850926 CTACAGGGGCAGGGCCCTCATGG - Intergenic
943219845 2:185090644-185090666 CTACAGTGGCAGGGCCCTCATGG + Intergenic
943386718 2:187210684-187210706 CTACACAGGCAGGGCCCTCATGG + Intergenic
943511261 2:188830435-188830457 CTACAGGGGCAGGGCCCTCATGG + Intergenic
944498165 2:200329541-200329563 CTACACCTGCAGCTGCCTCCTGG + Intronic
946889928 2:224264791-224264813 CTACTCCTGCAGGTCTCTTAGGG - Intergenic
948588335 2:239035085-239035107 CTGCACCCGCAGCTCCCACGTGG - Intergenic
1168761759 20:354364-354386 CTCCACCCTGAGGACCCTCAGGG - Exonic
1172313571 20:33936284-33936306 CTTCACCCTCTGATCCCTCAAGG + Intergenic
1173152725 20:40581703-40581725 CTACACTTGCATGTCCCACAGGG + Intergenic
1174486861 20:50866640-50866662 CTCCAACCTCAGGACCCTCAGGG - Intronic
1175687184 20:61040072-61040094 CTACACCTGCCGGGCCCACACGG + Intergenic
1175810030 20:61852929-61852951 CTGCACCCGCAGAGCCCACAGGG - Intronic
1176197971 20:63846370-63846392 CCCCACCCGCACCTCCCTCAGGG - Intergenic
1179721196 21:43316788-43316810 ACACTCCCGCAGGTCCCTGAAGG + Intergenic
1179786991 21:43735657-43735679 CTAAACCAGCAGGCCCCCCATGG - Intronic
1180065994 21:45412711-45412733 CTTCACTTGCAGGACCCTCACGG - Intronic
1180232950 21:46438422-46438444 CCACATCCCCAGGTCCCTAAAGG - Intronic
1182876999 22:33700885-33700907 CTACACCCTCCTGTCCCTCCAGG - Intronic
1183927579 22:41217028-41217050 CTACCTCTGCAGGTCCCACAGGG + Intronic
1185008402 22:48299356-48299378 CCACACCCTCAGGTCCTCCATGG - Intergenic
1185097457 22:48819228-48819250 CTACACCAGAAGGTTTCTCAGGG + Intronic
957148705 3:76457675-76457697 CTGCACGGGCAGGGCCCTCATGG - Intronic
957738651 3:84233937-84233959 CTACAGGGGCAGGACCCTCATGG - Intergenic
961495314 3:127287362-127287384 CCACTCCCGCAGATTCCTCATGG - Intergenic
968097933 3:195945331-195945353 CTGCAGCTGCAGGACCCTCAAGG + Intergenic
968305148 3:197645637-197645659 CTGCAGCTGCAGGACCCTCAAGG + Intergenic
969580465 4:8061717-8061739 CTGCACCCGCCGTGCCCTCAGGG - Intronic
971793645 4:31199575-31199597 CTACAGGGGGAGGTCCCTCATGG - Intergenic
977669949 4:99684164-99684186 CTACCCCCGCTAGTCCCTCCAGG + Intergenic
982178472 4:152728392-152728414 CTGCTCCTTCAGGTCCCTCAAGG - Intronic
982477216 4:155868220-155868242 CTACAGGGGCAGGGCCCTCATGG - Intronic
984011254 4:174374650-174374672 CTACACCCCCAAGTCCAGCAAGG + Intergenic
985742209 5:1625015-1625037 CTGCAGCTGCAGGGCCCTCAAGG + Intergenic
990320935 5:54628990-54629012 CTACACCGGAAAGTCCTTCAAGG + Intergenic
996766606 5:127040564-127040586 CTACTCCCCCAGGGCCATCAGGG - Intergenic
998461646 5:142314394-142314416 CTGCGCCCGCTGGTCCTTCATGG - Exonic
1000920639 5:167132858-167132880 CTAAGCCCCCAGGTCCCTCAGGG + Intergenic
1006358741 6:33575765-33575787 CTACAACCGCTGGGCCCACAAGG - Intronic
1008071549 6:47103568-47103590 CTACAGCTGCTGGTCCCTCGGGG + Intergenic
1011942279 6:92857373-92857395 CTACAGGGGCAGGGCCCTCATGG - Intergenic
1013935384 6:115587510-115587532 CTACAGGGGCAGGGCCCTCATGG + Intergenic
1014000091 6:116355769-116355791 CTACAGCTGCAGCTCCATCAAGG + Intronic
1016537642 6:145126447-145126469 CTACAGGGGCAGGGCCCTCATGG + Intergenic
1019055774 6:169222271-169222293 CTACTCCGGCGTGTCCCTCAAGG - Exonic
1019609143 7:1928188-1928210 CACCACCCGCCGGTCCCTAAAGG + Intronic
1019689838 7:2404195-2404217 CAGCACCGGCAGGTCGCTCAGGG + Intronic
1023060496 7:36321790-36321812 CTGCAGGGGCAGGTCCCTCATGG + Intergenic
1027251489 7:76401256-76401278 TTACACCCGCAGATCTCTCTAGG - Intronic
1033031585 7:137832302-137832324 CTACAGGGGCAGGGCCCTCATGG - Intronic
1037848534 8:22306476-22306498 CAACACCCCCAGGACACTCAGGG - Intronic
1039822538 8:41146524-41146546 CTCCACCTGCAGGTCCCTCCTGG - Intergenic
1041222962 8:55670233-55670255 CTACAGGGGCAGGGCCCTCATGG + Intergenic
1048362560 8:133710737-133710759 CTACACTGGCAGGGACCTCATGG - Intergenic
1060410178 9:123394981-123395003 CTACAGCCGTGGCTCCCTCATGG + Intronic
1060965746 9:127711549-127711571 CTACCCCTGCAGGGCCCCCAGGG - Intronic
1061074616 9:128333578-128333600 CTCCTCCCGCAGAGCCCTCAGGG - Exonic
1062444238 9:136587037-136587059 CTGCACCCTCAGGTCCCGCTCGG - Intergenic
1188755148 X:33952959-33952981 CTACAGGGGCAGGGCCCTCATGG - Intergenic
1188865180 X:35305511-35305533 CTACAACAGCAGAGCCCTCATGG + Intergenic
1189633175 X:42976288-42976310 CTAATCCCCCAGATCCCTCAGGG - Intergenic
1191192221 X:57679223-57679245 CAACAGCCGGAGGTCTCTCAGGG + Intergenic
1192351835 X:70362308-70362330 CTACATCCGCAGCACCCCCACGG - Intronic
1199070394 X:143469046-143469068 CTACAGCAGCAGGGCCCTCATGG - Intergenic
1200137019 X:153880101-153880123 CTACACCCGCAGGTCCCTCAGGG + Intronic
1201743749 Y:17349450-17349472 ATAGACCCACAGGTGCCTCAGGG + Intergenic