ID: 1200138815

View in Genome Browser
Species Human (GRCh38)
Location X:153887220-153887242
Sequence CAAGTGGTGTGGGGCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 275}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200138805_1200138815 4 Left 1200138805 X:153887193-153887215 CCCTCGACTCAGTCTCACAAGAC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1200138815 X:153887220-153887242 CAAGTGGTGTGGGGCCCTGGAGG 0: 1
1: 0
2: 0
3: 25
4: 275
1200138806_1200138815 3 Left 1200138806 X:153887194-153887216 CCTCGACTCAGTCTCACAAGACT 0: 1
1: 0
2: 0
3: 18
4: 84
Right 1200138815 X:153887220-153887242 CAAGTGGTGTGGGGCCCTGGAGG 0: 1
1: 0
2: 0
3: 25
4: 275
1200138802_1200138815 25 Left 1200138802 X:153887172-153887194 CCCAGTGAAGCATTCCAGGGGCC 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1200138815 X:153887220-153887242 CAAGTGGTGTGGGGCCCTGGAGG 0: 1
1: 0
2: 0
3: 25
4: 275
1200138803_1200138815 24 Left 1200138803 X:153887173-153887195 CCAGTGAAGCATTCCAGGGGCCC 0: 1
1: 0
2: 0
3: 4
4: 113
Right 1200138815 X:153887220-153887242 CAAGTGGTGTGGGGCCCTGGAGG 0: 1
1: 0
2: 0
3: 25
4: 275
1200138804_1200138815 11 Left 1200138804 X:153887186-153887208 CCAGGGGCCCTCGACTCAGTCTC 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1200138815 X:153887220-153887242 CAAGTGGTGTGGGGCCCTGGAGG 0: 1
1: 0
2: 0
3: 25
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200138815 Original CRISPR CAAGTGGTGTGGGGCCCTGG AGG Intronic
900001921 1:19229-19251 CACGTGGAGTGTGGCCCTGTGGG - Intergenic
900354083 1:2251538-2251560 CAGGTCGTGTGGGGCCATCGAGG + Intronic
900374555 1:2347515-2347537 CATGGGGTGTGTGGGCCTGGGGG - Intronic
900398589 1:2463553-2463575 CCAGCGGTGTGGGGCCTTCGTGG - Intronic
900594495 1:3474565-3474587 TACGTGCTGTGGGGCCCTGCAGG + Intronic
900616262 1:3567030-3567052 GCTGGGGTGTGGGGCCCTGGTGG - Intronic
900691228 1:3981899-3981921 CATGAGGTGAGGGGCCCTGGGGG + Intergenic
900931518 1:5741025-5741047 CAGGGGCTGTGGCGCCCTGGGGG + Intergenic
903336374 1:22627262-22627284 CAAGTGGGGAGAGGCACTGGAGG - Intergenic
903875186 1:26469169-26469191 GAAGGGGAGTGGAGCCCTGGAGG - Exonic
905183529 1:36180350-36180372 GAAGTGGCCTGGGCCCCTGGGGG + Exonic
905800386 1:40838939-40838961 CAAGTGGGGCGGGGACTTGGCGG - Exonic
906533244 1:46535814-46535836 GAAGTGGATTGGGGCTCTGGTGG + Intergenic
907488887 1:54796271-54796293 CCAGCGGGGTGGGGACCTGGCGG - Intronic
909019015 1:70411044-70411066 CAAGTGGTGTTAGTCCCTGCGGG - Intergenic
912376249 1:109212247-109212269 GCAGTGGTGAGGGGCCCTGGGGG + Intergenic
914453823 1:147816948-147816970 CATGAGCTGTGGGGCCATGGCGG - Intergenic
918426910 1:184419874-184419896 CAGATTGTGTGAGGCCCTGGAGG + Intronic
920296367 1:204959613-204959635 CAAGGAGAGAGGGGCCCTGGTGG - Intronic
920312535 1:205057067-205057089 CATGTGGGGTGGGGACTTGGAGG - Intronic
921710522 1:218368859-218368881 TAAGTGATGTGGGGCCTTGTAGG + Intronic
1067061569 10:43080555-43080577 CCAGTGGTGTGGGTCCAGGGTGG + Intronic
1067145095 10:43688914-43688936 AAAGAGGTGTGGGGTCCTGAGGG + Intergenic
1070829566 10:79410134-79410156 CAAATGGTGTGGGCATCTGGGGG - Intronic
1072233022 10:93429054-93429076 ATAGTGGAGTTGGGCCCTGGTGG + Intronic
1073292231 10:102419004-102419026 CAAGTGGGGTGGGGCACGTGAGG - Exonic
1073514190 10:104062395-104062417 AAAGTGGTTTGGGACTCTGGGGG - Intronic
1074229916 10:111523576-111523598 CAAGTCCTGTGGAGGCCTGGGGG - Intergenic
1074826576 10:117219208-117219230 GAAGTGGTGTTGTGCCCTGGTGG + Intergenic
1076527802 10:131123392-131123414 GAAGAGGTGAGGAGCCCTGGGGG + Intronic
1076730401 10:132436266-132436288 CAAGTGGAGAAGGGGCCTGGGGG - Intergenic
1076886992 10:133267536-133267558 CATCTGGGGTGGGGCCCTGTGGG - Intronic
1077210390 11:1368448-1368470 AAAGTGGCCTTGGGCCCTGGCGG + Intergenic
1077218720 11:1405859-1405881 CAAGGGGTGTGGGGCCTGCGGGG - Intronic
1078059901 11:8036515-8036537 CATGTTCTGTGGGGCCATGGAGG + Intronic
1078239171 11:9514551-9514573 AAAGTGCTGTGGCACCCTGGAGG + Intronic
1078662642 11:13299507-13299529 TAGGTGGTTTGGGGCCATGGGGG + Intronic
1079088370 11:17463284-17463306 AAAGGGGAGTGGGGCCGTGGCGG - Intronic
1081659957 11:44882059-44882081 CAAGTGGTTAGGGTCCCTGGTGG + Intronic
1081865154 11:46355669-46355691 AGAGTGGGGTGGGGCCCTGGGGG + Intronic
1081964466 11:47161256-47161278 CAAGTGGTGTTGGCCCCAGATGG - Intronic
1082105305 11:48215156-48215178 CAAGGGGTCTGGTGGCCTGGAGG - Intergenic
1084004660 11:66316622-66316644 CCAGCGCTGTGTGGCCCTGGAGG - Exonic
1084891071 11:72237467-72237489 CCAGTGGTCCGGGGCCGTGGTGG + Exonic
1085207445 11:74744631-74744653 CAACAGCAGTGGGGCCCTGGTGG - Intergenic
1086882444 11:92165378-92165400 CTAGGGTTGTGGGGCCATGGAGG - Intergenic
1087353275 11:97060413-97060435 CACATAGTCTGGGGCCCTGGGGG + Intergenic
1087390197 11:97521490-97521512 CAAGAGGTCTGGGGCTCAGGAGG + Intergenic
1087653482 11:100895985-100896007 CAGGGAGTGTGGGGGCCTGGTGG - Intronic
1088373055 11:109112381-109112403 CTTGTACTGTGGGGCCCTGGAGG - Intergenic
1088600910 11:111474131-111474153 AAAGTGGATTGGGGCCCAGGAGG - Intronic
1091375001 12:19334-19356 CACGTGGAGTGTGGCCCTGTGGG - Intergenic
1092091579 12:5808222-5808244 CAAGTGGTGTGAGACACTGTTGG - Intronic
1093672293 12:21891444-21891466 CAAATGGTGTTGGGTGCTGGGGG + Intronic
1094817113 12:34198963-34198985 CGAGTTGTGTGAGCCCCTGGAGG + Intergenic
1095584357 12:43834618-43834640 CCAGTGGTGTGGGGATGTGGGGG + Intergenic
1097259986 12:57713679-57713701 AAAGTGGGGTGGGGCGGTGGAGG - Intronic
1097270269 12:57769752-57769774 CAGGTGGGGAGGGGCCCTGGTGG - Exonic
1099004957 12:77224815-77224837 CAAGTGGAGTGGGGGCATTGGGG + Intergenic
1099298442 12:80861117-80861139 CAAGTGGTGACTGACCCTGGTGG + Intronic
1101012046 12:100460767-100460789 CATGAGGTGAAGGGCCCTGGAGG - Intergenic
1101421708 12:104556198-104556220 AAGATGGTGTGGGGCCCTGTGGG + Intronic
1102361147 12:112288750-112288772 CAAGTGGAGAGAGGCCCTAGAGG + Intronic
1103348161 12:120265108-120265130 GAAGTGGGGGGCGGCCCTGGAGG + Intronic
1103568650 12:121830007-121830029 GCAGTGGTGGGGGACCCTGGGGG + Intronic
1104702640 12:130918667-130918689 CAGGTGGTTTGGGGGCCAGGTGG + Intergenic
1104787401 12:131458400-131458422 AAAGAGGTTTGGAGCCCTGGTGG - Intergenic
1105018898 12:132803536-132803558 AAAGTAGTTTGGGGCCCTGTGGG - Intronic
1106311276 13:28556719-28556741 CAAATGGTGTGGGGACGTGGAGG + Intergenic
1106753197 13:32796005-32796027 GCAGTGGTGTGGCTCCCTGGAGG + Intergenic
1107451906 13:40517420-40517442 CAGGTGGTGTGGGTCTCTTGTGG - Intergenic
1108005836 13:45945520-45945542 CAATTGGTGTGTGTCCGTGGAGG + Intergenic
1108062094 13:46543619-46543641 CAAGTAGTGTGTAGCCATGGAGG + Intergenic
1108371649 13:49775400-49775422 CATGTGGTGTGCTGCCCTAGGGG - Intronic
1109569246 13:64164545-64164567 CAGCTGGGGTGGGGCGCTGGTGG + Intergenic
1110258598 13:73459496-73459518 CCAGTGGTGGGGGGCTCTGAGGG + Intergenic
1112294166 13:98171986-98172008 CAGGTGTTGTGGCGCTCTGGGGG + Intronic
1113360171 13:109623235-109623257 CAAATGGTGTGGGCCCCAGATGG + Intergenic
1114796978 14:25727237-25727259 TCAGGGGTGTGGGGGCCTGGGGG - Intergenic
1117255557 14:53973647-53973669 CCAGTGGTGGGCAGCCCTGGAGG + Intergenic
1118103099 14:62627881-62627903 CAATTTGGGTAGGGCCCTGGAGG - Intergenic
1118318270 14:64738444-64738466 CAAGTGGGGTGGGGTGGTGGGGG + Intronic
1118617800 14:67586880-67586902 CCAGTGGTGTGGGCTCCTGTTGG - Intronic
1119801771 14:77451722-77451744 CAGGTGGTGTGTGCCTCTGGAGG - Intronic
1120760455 14:88280195-88280217 CAAGTGATGTGTGGCCGTGTTGG - Intronic
1120764979 14:88320764-88320786 CAAGTGCTGTGTGGCTCTTGTGG - Intronic
1120833904 14:89023262-89023284 CATGTGGTGTGGACCCCTGATGG + Intergenic
1121050324 14:90815974-90815996 CACGCGGTGTGGGGGCCCGGGGG - Intronic
1122227987 14:100290826-100290848 CCTGTGGTGAGGGGCACTGGCGG - Intergenic
1122289209 14:100670745-100670767 CCAGTGGAGATGGGCCCTGGGGG - Intergenic
1122488235 14:102095814-102095836 GAAATGGTGTGGGGCCCTGAGGG - Intronic
1122697472 14:103562986-103563008 CAGGGGGCGTGGGGCCATGGTGG + Exonic
1123909646 15:24954805-24954827 ACAGTGCTGTGGGGCCCTAGGGG + Intronic
1124010787 15:25836906-25836928 CAGGTGGTGTGTGGACCTGAAGG - Intronic
1124199719 15:27668588-27668610 CAAGTGGGGTGTGGCACTGTGGG + Intergenic
1128304548 15:66589324-66589346 GAAGTGTTGAGGGGACCTGGAGG + Intronic
1128359135 15:66948469-66948491 CATGAGCTGTGGGGCCCTGGAGG + Intergenic
1128630689 15:69263381-69263403 CAAGTGAGGTGAGACCCTGGAGG + Intronic
1128728857 15:70007118-70007140 CAAGTGGGGAAGGCCCCTGGGGG + Intergenic
1128765395 15:70248157-70248179 AAAGTGATGTGGGTACCTGGTGG - Intergenic
1130021274 15:80233893-80233915 CAAGTTGTGTGGGTTCCTGAGGG - Intergenic
1131365227 15:91833359-91833381 CCAGTGGGCTGGGGGCCTGGAGG + Intergenic
1132346962 15:101114313-101114335 CAAGAGGCGGGGGCCCCTGGGGG - Intergenic
1132455301 16:18918-18940 CACGTGGAGTGTGGCCCTGTGGG - Exonic
1132558852 16:584443-584465 CATGTGGGGTGGGCCCCTCGTGG + Intergenic
1132895810 16:2228884-2228906 CACGTGAAGTGTGGCCCTGGGGG + Intronic
1133297665 16:4762812-4762834 TGAGGGGTGTGGGGCCCTGCGGG - Intronic
1134056144 16:11171002-11171024 GATGTGGTTTGGGACCCTGGTGG - Intronic
1134111185 16:11516340-11516362 CAAGTGGCCTGGGGCACTGGAGG - Intronic
1139252929 16:65513531-65513553 CAAGTAGTGTGGGCCCTTTGAGG - Intergenic
1139754407 16:69131813-69131835 CGAGTGGGGTGGGGTCCTGGAGG - Intronic
1141603269 16:85138902-85138924 CAAGTGGCCTGGGGACATGGTGG - Intergenic
1141663475 16:85453904-85453926 CAGGTGGCCTGGGGCCCTGGAGG - Intergenic
1141664215 16:85457591-85457613 CAGGTAGCCTGGGGCCCTGGAGG - Intergenic
1141770212 16:86085330-86085352 CCAGTGGGGTGGGGCCTGGGGGG - Intergenic
1142286397 16:89173224-89173246 CAGGTGGGGAAGGGCCCTGGAGG - Intronic
1144773554 17:17772523-17772545 CACGTGGTGTGTGGCCCTCTGGG - Intronic
1145907779 17:28525711-28525733 CAAGAGGTGAGGGGGGCTGGTGG - Intronic
1146163453 17:30571806-30571828 CAAGTTGTGTAGGGCTGTGGGGG + Intergenic
1146946549 17:36877503-36877525 CCACTGGGGAGGGGCCCTGGGGG + Intergenic
1147602407 17:41754706-41754728 CACATGGTGTGGGGGGCTGGGGG - Exonic
1150229247 17:63541013-63541035 CAAGAGTTATGGGGCCATGGAGG - Intronic
1150302163 17:64055739-64055761 CGAGTGGTTGGAGGCCCTGGGGG + Exonic
1151384389 17:73746334-73746356 CAACAGGTGTGGGGCCAAGGTGG - Intergenic
1151459322 17:74245420-74245442 AAAGCGGGATGGGGCCCTGGAGG - Intronic
1151500004 17:74482406-74482428 CAAGTCGTGTGGTGCCATGGAGG + Intronic
1152244253 17:79177038-79177060 CTGGTGGTGTGGGACCCAGGGGG - Intronic
1152303201 17:79507240-79507262 CCAGTGCTCTGAGGCCCTGGCGG - Intronic
1152380923 17:79941918-79941940 CACGTGCTGGGGGGCCATGGTGG + Intronic
1152570801 17:81120501-81120523 CAGGCGGAGTGGGGCTCTGGGGG + Exonic
1152642518 17:81455111-81455133 CAGGGGGTGAGGGGCCCCGGGGG - Intronic
1152700278 17:81815160-81815182 GAAGTGCTGCTGGGCCCTGGGGG + Intergenic
1153547241 18:6220282-6220304 CAAGTTCTGTAGGGCCCTGTAGG - Intronic
1153778591 18:8475383-8475405 CAAGAGGTGTGGGGGCCAGGTGG - Intergenic
1153791856 18:8586306-8586328 CATGTGGTAGGGGGCCCAGGAGG + Intergenic
1154156401 18:11947710-11947732 CAAGTAGAGCTGGGCCCTGGCGG - Intergenic
1155910044 18:31496543-31496565 CAGGTGGTGTGAGCCCCTTGAGG + Intergenic
1156448233 18:37252504-37252526 CACCTGGTGTGGGGCCTTGAAGG - Intronic
1156493222 18:37508690-37508712 CAAGTGGTCTGGTGGACTGGGGG + Intronic
1157522735 18:48356536-48356558 GAAAAGGTGTGGGGACCTGGAGG - Intronic
1157801954 18:50628010-50628032 CAATGGGTGTGGTGGCCTGGTGG - Intronic
1158747276 18:60215657-60215679 CAAATGGTGTGGGGACTTTGGGG - Intergenic
1159550936 18:69894956-69894978 CAAATAGTGTGGTGCCTTGGAGG + Intronic
1161428700 19:4218181-4218203 CAATGGGGGTGGGGCCCGGGTGG - Intronic
1161604426 19:5206741-5206763 CCAGTGGTGTCGGGCCTGGGGGG + Exonic
1162753162 19:12841079-12841101 CCAGGGTTCTGGGGCCCTGGAGG - Intronic
1162927492 19:13937720-13937742 CCAGTGGTGAGGGGAGCTGGAGG - Intronic
1163152222 19:15422363-15422385 CAGGGGCTCTGGGGCCCTGGAGG - Exonic
1163288888 19:16365725-16365747 AGAGTGGTGAGGGACCCTGGGGG - Intronic
1163374510 19:16922041-16922063 AGAGTGGTGTAGGTCCCTGGGGG - Intronic
1163443564 19:17333879-17333901 GGAGTGGTGAGGAGCCCTGGCGG - Intronic
1163474229 19:17515715-17515737 CAAGGGCCGTGGGACCCTGGAGG + Intronic
1163906544 19:20153578-20153600 CAGGTTGTGTGAGGCCCTTGAGG + Intergenic
1164681381 19:30135931-30135953 CAGGAGGTCTGGGGTCCTGGGGG - Intergenic
1165735755 19:38174388-38174410 CAAGTGGCTGGGGGCCCTCGGGG + Intronic
1166945084 19:46391353-46391375 CCAGTGGTATGTGGCACTGGGGG + Intronic
1167101619 19:47407335-47407357 CAACTGGTGAGTGGCCCAGGAGG - Exonic
1167742199 19:51330270-51330292 GAGGGGGTGGGGGGCCCTGGGGG + Exonic
925478335 2:4243940-4243962 CGAGTGGAGTGGGATCCTGGTGG + Intergenic
925561930 2:5205476-5205498 CAAGGGCTGTGGGGGACTGGGGG - Intergenic
926891899 2:17645553-17645575 CACGCTGGGTGGGGCCCTGGAGG + Intronic
928246329 2:29631774-29631796 TAAATGGTGTGGGGCCTTGAGGG - Intronic
928435156 2:31250094-31250116 AAAATGGTGTGGGGCGGTGGGGG + Intronic
928836976 2:35559089-35559111 CATGTGGTGTTGGGCCAGGGTGG + Intergenic
929954223 2:46443186-46443208 CAGGTGGTATCGGGCCCTGTGGG - Intronic
930011637 2:46941901-46941923 CATGTGGTTTGGGGGCTTGGAGG + Intronic
933720759 2:85395963-85395985 CAAGAGGTGAGGGGTCCTAGAGG - Intronic
933780509 2:85797417-85797439 CAGGTGGTGCGGGGCCTTGAAGG - Intergenic
934562130 2:95318781-95318803 CAAGTGCTGTGGGGACGCGGAGG + Intronic
936371602 2:111906582-111906604 CAAGTGTTGTGTGTGCCTGGAGG + Intronic
937141503 2:119605670-119605692 CCAGTGGGGTGAGGCTCTGGGGG + Intronic
938086866 2:128407508-128407530 CATGAGGAGTGTGGCCCTGGGGG + Intergenic
942447297 2:176086313-176086335 GAAGTGGTGCGAGACCCTGGCGG + Intergenic
946867403 2:224054742-224054764 GAAGCAGTGTGGTGCCCTGGAGG + Intergenic
946931289 2:224674136-224674158 CACGTGGAAAGGGGCCCTGGAGG - Intergenic
947011516 2:225571488-225571510 CATGTGGTGCTGGGCCCTGTGGG - Intronic
947087692 2:226474445-226474467 CAAGTGGTGTGCAGCCATGCAGG - Intergenic
947712790 2:232325615-232325637 CCAGAGTGGTGGGGCCCTGGTGG + Intronic
948443211 2:238011191-238011213 CAAAGGGTGTTGGGCCCTGCAGG - Intronic
1168762247 20:357184-357206 CAAATTGTGTAGGGCCTTGGAGG - Intronic
1169328776 20:4699578-4699600 GCAGTGGTGGGGGGCCTTGGCGG + Exonic
1175522259 20:59609438-59609460 CAAGTGGGGTGGGCTCCAGGAGG - Intronic
1176081709 20:63276768-63276790 CAAGTTGTGTGTGGCCCAGTGGG - Intronic
1176148141 20:63574438-63574460 GACGGGGCGTGGGGCCCTGGAGG - Intergenic
1178639903 21:34337376-34337398 GAAGTGGTGAGGGGGCCTGGGGG + Intergenic
1179504832 21:41833428-41833450 CCAGTGGTGGGTGGCACTGGAGG - Intronic
1179505051 21:41834638-41834660 CCAGTGGTGGGTGGCACTGGAGG - Intronic
1180023490 21:45144760-45144782 CAAGTGGAAAGGTGCCCTGGTGG - Intronic
1180068358 21:45424038-45424060 GCAGTGCTGCGGGGCCCTGGTGG + Intronic
1181027587 22:20134714-20134736 CATGTGGTGTGGGGAGCTGGAGG + Intronic
1181687216 22:24537752-24537774 CAAGTGCTGTAGGGCCCTTTGGG - Intergenic
1183378315 22:37478045-37478067 GAAGTGGTGTGAGAGCCTGGGGG + Intronic
1183458809 22:37937204-37937226 CCAGGGGTGGGGGGTCCTGGGGG + Intronic
1184640587 22:45867992-45868014 GGAGTGGTGGGGGGCCCGGGGGG - Intergenic
1184864233 22:47193365-47193387 CAGGGGGTGTGGTGTCCTGGGGG + Intergenic
950069777 3:10142691-10142713 CACGTGGGGTGGGGGACTGGGGG - Intronic
950082826 3:10235537-10235559 CAAGTGGTGTTGGGCACAGAGGG + Intronic
953897130 3:46811487-46811509 AAAGTGGTCAGGGGTCCTGGAGG - Intronic
954636318 3:52072829-52072851 CAAGGAGTGTGGGGCCTGGGTGG - Intergenic
955818862 3:62875076-62875098 CAAAAGGTGGGGGGCGCTGGAGG + Exonic
957245108 3:77706506-77706528 CACGGGGTGTGGGGGGCTGGAGG + Intergenic
958196277 3:90245680-90245702 CAAGAGCTGTGGGGTCATGGTGG - Intergenic
961445139 3:126976953-126976975 CAAGTGGTGTGGCTCCCCTGTGG - Intergenic
961796916 3:129415702-129415724 GAAGTGGGGTGGGACCCTAGAGG - Intronic
962286741 3:134092609-134092631 CAAGTGGGGTGGAGCCATAGAGG + Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967774128 3:193368747-193368769 CCAGTGGGGTGGGGCGGTGGGGG - Intronic
968505230 4:968278-968300 CGAGTGGTGCGGGGTCCAGGTGG - Exonic
968591308 4:1461065-1461087 CAAGTGGTAGGGAGGCCTGGGGG - Intergenic
969306109 4:6327194-6327216 CAATGGGTGGGGTGCCCTGGGGG - Intronic
969530407 4:7727226-7727248 CAAGAGGACAGGGGCCCTGGAGG - Intronic
969686018 4:8674707-8674729 CCCGTGGGGTGGGGCCCTGTGGG + Intergenic
969717302 4:8873932-8873954 CTAGGGTTGTGTGGCCCTGGAGG + Intergenic
970826170 4:20278801-20278823 CCAGTGGTGGGGGGCGGTGGGGG + Intronic
976363015 4:84202630-84202652 CTACTGGTGTGGGCCCCTGAGGG - Intergenic
978376495 4:108079567-108079589 CCAGTTGTGTGGGGACCAGGAGG + Exonic
979180914 4:117726131-117726153 CACATGGTGTGGTGCCCTTGTGG - Intergenic
981580252 4:146243308-146243330 CCAGTGCTGTGGGACCCTGTTGG - Intergenic
985713988 5:1445637-1445659 CACGGGGTGCGGGGGCCTGGGGG + Intergenic
985865557 5:2511404-2511426 CATGTGCTCAGGGGCCCTGGAGG + Intergenic
986014241 5:3743781-3743803 CCAGTGGAGTGTGGCACTGGAGG + Intergenic
987092842 5:14522946-14522968 CAGGTGGTCAGGGGCCATGGGGG + Intronic
989780904 5:45263486-45263508 CAAGTGGGGTCAGGCCCAGGAGG - Intronic
991504392 5:67308923-67308945 CCAGCTGTGTGTGGCCCTGGAGG - Intergenic
993330665 5:86596208-86596230 CAAGTGGTCAGGTGCCCTGGTGG + Intergenic
995903292 5:117094159-117094181 AAAGCGAAGTGGGGCCCTGGAGG - Intergenic
996915141 5:128703316-128703338 CATGAGCTGTGGGGCCATGGTGG + Intronic
998690020 5:144577170-144577192 AAACTGGTGAGTGGCCCTGGGGG + Intergenic
999269487 5:150288590-150288612 CACGGGGGGAGGGGCCCTGGAGG - Intronic
999424513 5:151475660-151475682 CAGGTGGTGGGGGACACTGGGGG + Intronic
1001175900 5:169468677-169468699 TAAATGGAGTTGGGCCCTGGAGG - Intergenic
1001279791 5:170378630-170378652 CAAGTGGGGAGCAGCCCTGGGGG + Exonic
1001955404 5:175845306-175845328 CAGGTGATGTGGGGCCTTGCGGG - Intronic
1002639825 5:180625496-180625518 CCAGCGGGGTGGGGACCTGGGGG - Intronic
1002926617 6:1609178-1609200 CAAGGGGTGCGGGGCCCTGCTGG - Intergenic
1006297836 6:33177928-33177950 CATGTGGCGTGGTGCCCTGAGGG - Intronic
1006445977 6:34080002-34080024 CAAATTGCATGGGGCCCTGGGGG - Intronic
1006680953 6:35796399-35796421 GAGGTGGTGTGGGGCAGTGGTGG + Intronic
1007364726 6:41383424-41383446 CATGTGGGGAGGCGCCCTGGTGG - Intergenic
1007711276 6:43825851-43825873 CAGGTGGTGTGGAGCTCTGGGGG + Intergenic
1008059450 6:46982024-46982046 AAAATGGTGTGGTGCCATGGAGG - Intergenic
1011281600 6:85683564-85683586 GAAGTGGAGTGGAGCCCAGGTGG + Intergenic
1011495793 6:87935737-87935759 CAACTGGTGGGGGTTCCTGGAGG + Intergenic
1014937732 6:127403762-127403784 CAAGTTGTGTAGGGCCTTGTAGG - Intergenic
1018480373 6:164183708-164183730 CAAGTGGTGTGGGAGCCATGTGG + Intergenic
1019117333 6:169775520-169775542 CAACTGGCATGGGGCCCTGGTGG + Intronic
1019428808 7:989128-989150 TAGGTGCTGGGGGGCCCTGGGGG - Exonic
1019570257 7:1708100-1708122 GAAGTGCTGTGGGGTGCTGGTGG - Intronic
1019737217 7:2656529-2656551 AAAGAGGTGAGGGGCCCTGGGGG + Exonic
1019740041 7:2668199-2668221 CAAGGGGTGTGGGACGGTGGTGG + Intergenic
1020098601 7:5382044-5382066 AAAGTGGCCTGGGGCCCTGCTGG - Intronic
1021971383 7:25968733-25968755 CAAGTGATGTGGCGGCGTGGTGG + Intergenic
1021980023 7:26045153-26045175 CAAATGGAGTGAGGGCCTGGTGG - Intergenic
1022456800 7:30564783-30564805 CTGGAGGTGTGGGGTCCTGGAGG + Intergenic
1024094997 7:45976266-45976288 CAAGTTCTTGGGGGCCCTGGTGG - Intergenic
1024306107 7:47930907-47930929 CAAGTGGCATGGGTCCCTGATGG + Intronic
1024838911 7:53560659-53560681 CATGTGGAGGGGGGACCTGGTGG + Intergenic
1025145253 7:56496125-56496147 CACGTGGTTAGGGGCCCTGATGG + Intergenic
1026300240 7:69091235-69091257 CAAGGGGTGTTGTGACCTGGAGG - Intergenic
1026602351 7:71787199-71787221 TAAGTGGGGTGCAGCCCTGGCGG - Exonic
1027001651 7:74658200-74658222 CGCGCGGTGTGGGGCCTTGGGGG + Intronic
1029586133 7:101472793-101472815 GAAGTGTTGTGGGGCCCCAGGGG + Intronic
1029952743 7:104604142-104604164 CATGAGCTGTGGGGCCATGGCGG - Intronic
1033343347 7:140508738-140508760 GAAGTGGGGTTGGGCCCAGGAGG + Intergenic
1035023710 7:155813438-155813460 CAAGGGGTCAGGGGCCCTGGGGG + Intergenic
1035166581 7:156993959-156993981 CTTGAGGTGTGGGGCCCTGGGGG + Intergenic
1035395267 7:158530823-158530845 CAAGAGGTGTCGGGCCATGTGGG + Intronic
1035775465 8:2184125-2184147 CATGTGGTGTGAGGGCCTGAAGG + Intergenic
1036795706 8:11755039-11755061 CAAGAGGCCTGGGGACCTGGAGG - Exonic
1040747008 8:50656443-50656465 GAAGTGGTGTGCCGCCCTAGTGG + Intronic
1041426438 8:57726074-57726096 CCTGTGGTGAGGGGCCCTGATGG - Intergenic
1041729904 8:61052718-61052740 CAGGTGGCGTGGGGCTCTGAGGG + Intergenic
1044055925 8:87569703-87569725 CATGTGGTGTTGGGCCCGAGGGG + Intronic
1044496771 8:92896320-92896342 CATGAGCTGTGGGGCCATGGAGG + Intronic
1044519904 8:93187335-93187357 GAAGTGGTGGGGGGTCCTGGGGG + Intergenic
1045738196 8:105319679-105319701 CGGGTGGTGTCTGGCCCTGGTGG + Intronic
1048963201 8:139596916-139596938 CCAGGGGTTTGGTGCCCTGGAGG - Intergenic
1049651676 8:143772492-143772514 CCAGAGGTGTGGGCCCCGGGAGG + Intergenic
1050056476 9:1660650-1660672 CACTTGGTGTAGGGCCCTGCAGG - Intergenic
1052731491 9:32291403-32291425 CTATTGGGGTGGGGCCATGGTGG - Intergenic
1053351200 9:37414474-37414496 CCAGTGAGGTGTGGCCCTGGGGG - Intergenic
1053758416 9:41332784-41332806 CCAGCTGTGTGAGGCCCTGGGGG + Intergenic
1055513035 9:77013934-77013956 CAAGAGGTGTGAGGCGCGGGTGG + Intergenic
1057744364 9:97739746-97739768 CAAGTGGTGAGAGGGCATGGAGG - Intergenic
1058302975 9:103398960-103398982 CAACTGGGGTGGGGCAATGGCGG + Intergenic
1058707594 9:107650143-107650165 CCAGTGGGGTGGGACCTTGGAGG - Intergenic
1061328025 9:129875725-129875747 AGTGTGGTGTGGGGTCCTGGTGG - Intronic
1062067975 9:134539010-134539032 CAATGGCTGTGGGGCCCGGGAGG - Intergenic
1062243645 9:135552511-135552533 CAAGTGGTGTGGATCCTCGGGGG + Intergenic
1186849390 X:13565712-13565734 CAAGTAGTGGGGGCCCTTGGTGG - Intergenic
1190709758 X:53058714-53058736 CCAGTGGGGTGGGGCACGGGAGG + Intronic
1191630207 X:63314095-63314117 CAGGTGGTGTGAGCCCCTTGAGG - Intergenic
1193851897 X:86547121-86547143 CAACTGGATTGGGGCACTGGAGG - Intronic
1194450573 X:94040566-94040588 GAATTGGAGTGGGGGCCTGGAGG + Intergenic
1197058387 X:122147942-122147964 CAAGAGCTGTGGGGCCATGGTGG + Intergenic
1199216591 X:145266242-145266264 CAACTGGGGTGGGGCACTGCTGG - Intergenic
1200079956 X:153571429-153571451 CGCGTGGAGTGGGGCCGTGGTGG - Intronic
1200138815 X:153887220-153887242 CAAGTGGTGTGGGGCCCTGGAGG + Intronic
1200401079 X:156020810-156020832 CACGTGGAGTGTGGCCCTGTGGG + Intergenic
1201762019 Y:17550954-17550976 CAAGTTGTGTGAGCCCCTTGAGG + Intergenic
1201839533 Y:18355036-18355058 CAAGTTGTGTGAGCCCCTTGAGG - Intergenic