ID: 1200138826

View in Genome Browser
Species Human (GRCh38)
Location X:153887259-153887281
Sequence GCATCCAAGCCAGGATGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 240}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200138826_1200138839 17 Left 1200138826 X:153887259-153887281 CCCTGGCATCCTGGCTTGGATGC 0: 1
1: 0
2: 1
3: 27
4: 240
Right 1200138839 X:153887299-153887321 AGCTTCAGTTCCCCTGGAATGGG 0: 1
1: 0
2: 3
3: 22
4: 186
1200138826_1200138841 26 Left 1200138826 X:153887259-153887281 CCCTGGCATCCTGGCTTGGATGC 0: 1
1: 0
2: 1
3: 27
4: 240
Right 1200138841 X:153887308-153887330 TCCCCTGGAATGGGAAGCTTGGG 0: 1
1: 0
2: 0
3: 13
4: 161
1200138826_1200138838 16 Left 1200138826 X:153887259-153887281 CCCTGGCATCCTGGCTTGGATGC 0: 1
1: 0
2: 1
3: 27
4: 240
Right 1200138838 X:153887298-153887320 CAGCTTCAGTTCCCCTGGAATGG 0: 1
1: 1
2: 0
3: 14
4: 172
1200138826_1200138843 27 Left 1200138826 X:153887259-153887281 CCCTGGCATCCTGGCTTGGATGC 0: 1
1: 0
2: 1
3: 27
4: 240
Right 1200138843 X:153887309-153887331 CCCCTGGAATGGGAAGCTTGGGG 0: 1
1: 0
2: 2
3: 11
4: 206
1200138826_1200138836 11 Left 1200138826 X:153887259-153887281 CCCTGGCATCCTGGCTTGGATGC 0: 1
1: 0
2: 1
3: 27
4: 240
Right 1200138836 X:153887293-153887315 AGTGCCAGCTTCAGTTCCCCTGG 0: 1
1: 0
2: 3
3: 10
4: 180
1200138826_1200138846 30 Left 1200138826 X:153887259-153887281 CCCTGGCATCCTGGCTTGGATGC 0: 1
1: 0
2: 1
3: 27
4: 240
Right 1200138846 X:153887312-153887334 CTGGAATGGGAAGCTTGGGGTGG 0: 1
1: 0
2: 3
3: 41
4: 372
1200138826_1200138840 25 Left 1200138826 X:153887259-153887281 CCCTGGCATCCTGGCTTGGATGC 0: 1
1: 0
2: 1
3: 27
4: 240
Right 1200138840 X:153887307-153887329 TTCCCCTGGAATGGGAAGCTTGG 0: 1
1: 1
2: 1
3: 19
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200138826 Original CRISPR GCATCCAAGCCAGGATGCCA GGG (reversed) Intronic
901180181 1:7336350-7336372 TCCTCCAAGCCAGGAATCCATGG - Intronic
901458208 1:9376037-9376059 CCAGCCAAGCCAGGGTGCCTCGG + Intergenic
901506907 1:9690587-9690609 GCATCCGAGCCCGCATGCCTGGG + Intronic
901686548 1:10946663-10946685 GCATCTAAGCCAGGGAGCCTGGG + Exonic
901873928 1:12155240-12155262 GCAGCCCAGCCAGGCTGCAAAGG - Intergenic
902409671 1:16205627-16205649 CCAGGCGAGCCAGGATGCCAGGG + Exonic
903123731 1:21233712-21233734 TCTTCCAAGACAGGAAGCCAAGG + Intronic
905494972 1:38377774-38377796 GCATCCAAGCCAGCAAGAGATGG + Intergenic
905745456 1:40413361-40413383 CATTCCAAGCCAGAATGCCAAGG + Intronic
905868750 1:41391155-41391177 GCATCAAGGCCAGGGTGGCAGGG + Intergenic
907387073 1:54133006-54133028 GGATTCCAGCCAGGATGCAAAGG + Intergenic
907431785 1:54416423-54416445 GCTTCCAACCCAGGAGGCCCAGG + Intergenic
907885771 1:58591263-58591285 GCATGCATGCCAAGACGCCAAGG - Intergenic
911013880 1:93310982-93311004 GCACACTAGCCTGGATGCCAAGG + Intergenic
911508791 1:98785990-98786012 TCACCCAAGCCAGAATGCAATGG - Intergenic
912247103 1:107970914-107970936 GCTTCCAATTCAGGAGGCCAGGG + Intergenic
912529557 1:110310471-110310493 GCATCCAAACCAGCAAACCAGGG + Intergenic
912816736 1:112835104-112835126 GCACCCCAGCCTGGATGACAGGG + Intergenic
913441560 1:118903865-118903887 GCATGTATGCCAAGATGCCATGG + Intronic
914991788 1:152505131-152505153 GCCTGGAAGCGAGGATGCCATGG - Intergenic
916702399 1:167311301-167311323 CCATGCAAGCCAGGAGGCCAAGG + Intronic
917542916 1:175933057-175933079 GCATCCCAGCCTGGGTGACAGGG - Intergenic
920820909 1:209379823-209379845 GCTTTCATGCCAGGAAGCCAGGG + Intergenic
922177257 1:223206271-223206293 GCATCCAAGCATGGAGGACAGGG + Intergenic
923558720 1:235022130-235022152 GCCTCCAAGTCAGGACCCCAGGG - Intergenic
924223188 1:241899037-241899059 GCCTTCACTCCAGGATGCCATGG + Intergenic
1067147042 10:43701524-43701546 GCATGCAAACCAGGCTGCCCAGG - Intergenic
1068046365 10:51891227-51891249 GCACCCAAGCCAGGGTGACAGGG + Intronic
1071604971 10:86979655-86979677 GCATCAAAGCCAGGCAGGCAGGG + Intronic
1073693593 10:105839459-105839481 GCATTCAAGCAATAATGCCAAGG + Intergenic
1075908460 10:126103419-126103441 GCATCACAGGCATGATGCCACGG + Intronic
1076944054 10:133631878-133631900 GCACCCCAGCCAGAATGACAGGG + Intergenic
1077115488 11:882826-882848 GCATTCAACCCAGGAGGCCCCGG + Intronic
1077162971 11:1121966-1121988 CCTTCCATGCCAGGCTGCCAGGG - Intergenic
1078758138 11:14230701-14230723 GCATCCAAGCCTGTTTCCCAGGG - Intronic
1079219162 11:18544341-18544363 GCATTCAAGCCTGGGTGACAGGG - Intronic
1081503608 11:43691748-43691770 GCATCCAAGGAAGGGTGCAAAGG - Intronic
1081871235 11:46383494-46383516 GACGCCAAGCCTGGATGCCAAGG + Exonic
1084218585 11:67664653-67664675 GGCTCCAGGCCAGGATCCCAAGG + Intronic
1084529958 11:69721335-69721357 GCAGCCAAGCCAGTGAGCCAGGG - Intergenic
1085390936 11:76181836-76181858 GGATCCAAGCCAGGCTGCCTTGG - Intergenic
1089058480 11:115607046-115607068 GAATCCAACCCTGGATACCAGGG - Intergenic
1090208534 11:124899037-124899059 GCACCGAAGCCAGGATGGGAAGG - Intergenic
1091196635 11:133737104-133737126 GGATCCAAGCAGGGATGCAAAGG + Intergenic
1092804035 12:12202506-12202528 GCATTCCAGCCCGGATGACAAGG + Intronic
1092914969 12:13181420-13181442 GCACTCAAGCCTGGATGACAGGG - Intergenic
1094150778 12:27280617-27280639 GCATCTTCGCCAGGATGACATGG + Intronic
1094818761 12:34209214-34209236 GCATCCAGGCCAGGGTGGCAGGG - Intergenic
1096798396 12:54092802-54092824 GCATCCAAGGAAGGAGGCCTTGG + Intergenic
1096840775 12:54378353-54378375 GTGTCCAAGCCAGCATCCCAGGG - Intronic
1097261587 12:57723548-57723570 GCATCCAAGCAAGGCAGCCCAGG + Intergenic
1099553841 12:84083524-84083546 TCACCCAAGCCTGGATGCCCAGG + Intergenic
1101048440 12:100835477-100835499 ACATCAAAGCAATGATGCCAAGG - Intronic
1101585977 12:106086311-106086333 GCATCCAATCTAGGGTACCACGG - Intronic
1102678502 12:114674353-114674375 GCACCCCAGCCAGTTTGCCATGG - Exonic
1104926128 12:132314807-132314829 GCATGAATGCCAGGATTCCACGG - Intronic
1105210416 13:18253913-18253935 GCCTCCAGCCCAGGATGCCCTGG + Intergenic
1106605310 13:31223475-31223497 GCTTCCAGGCCAGGATGCTCGGG - Intronic
1107159000 13:37203837-37203859 GCATTCCAGCCTGGATGACAGGG - Intergenic
1108086291 13:46796932-46796954 CCATCCATGACAGGAGGCCAAGG - Intronic
1108435197 13:50395701-50395723 GCTTTGAAGCCAGGATGCCTGGG + Intronic
1113198804 13:107840973-107840995 TTTTCCAAGCCAGGATGCTAGGG - Intronic
1113990765 14:16025415-16025437 GCATCCAGGCCAGGGTAGCAGGG - Intergenic
1114069193 14:19094723-19094745 GCATCAAAGCCAGGCAGGCAGGG - Intergenic
1114093067 14:19305280-19305302 GCATCAAAGCCAGGCAGGCAGGG + Intergenic
1114746093 14:25148930-25148952 GCACCCCAGCCTGGATGACAGGG - Intergenic
1119588746 14:75863973-75863995 CTGTCCAAGCCAGGATGGCACGG - Intronic
1120223348 14:81760751-81760773 GCAGCCAAATCAGGATGGCAAGG - Intergenic
1120532583 14:85650879-85650901 GCATCCTAGCCTGGATGACAGGG - Exonic
1122769678 14:104092420-104092442 GGCTCCAAGGCAGGAAGCCATGG + Intronic
1122778394 14:104133242-104133264 GGAGCCCAGCCAGGATCCCACGG - Intergenic
1124512396 15:30338269-30338291 GCTTCCAAGCCAGAAAGCCTTGG - Intergenic
1124730518 15:32192482-32192504 GCTTCCAAGCCAGAAAGCCTTGG + Intergenic
1126163193 15:45632631-45632653 ACATCCAAGCCAAGAAGCCCTGG - Intronic
1126430070 15:48573849-48573871 GCAGACAGGCCAGGACGCCATGG + Intronic
1127781742 15:62322653-62322675 GCACCCCAGCCAGGGTGACAGGG - Intergenic
1128769340 15:70270180-70270202 TCAGCCATGGCAGGATGCCAAGG + Intergenic
1129182611 15:73886692-73886714 CCATCCAAGCCAGGAAGAAAGGG - Intronic
1131178675 15:90225584-90225606 GCATACAAGCCGGGTGGCCATGG + Intronic
1131834029 15:96372465-96372487 ACATGGATGCCAGGATGCCAAGG + Intergenic
1132110679 15:99099993-99100015 GGATCCAAGCAACGATCCCACGG - Intronic
1132490501 16:227241-227263 CCGTCCCAGCCAGGATGTCATGG + Exonic
1132940074 16:2502053-2502075 GCATCCATGCAAGGTGGCCAAGG - Exonic
1133562355 16:6961852-6961874 CCACCCAAACCAGGATGGCAAGG - Intronic
1134239487 16:12494932-12494954 GCATGCCAGGCAGGGTGCCAAGG + Intronic
1136449920 16:30348072-30348094 GCATTCAGGCCTGGGTGCCATGG + Intergenic
1136909946 16:34136571-34136593 GCATCCAGGCCAGGGTGGCAGGG - Intergenic
1137703237 16:50513554-50513576 TCACCCAAGCCAGAGTGCCATGG - Intergenic
1139052112 16:63136940-63136962 CCATGCAAGCCAGTATGCAATGG + Intergenic
1139705609 16:68738327-68738349 GCGTCAAAGCCAGGGTGGCAGGG - Exonic
1140397135 16:74637180-74637202 GCACTCCAGCCTGGATGCCATGG - Intronic
1141803677 16:86328088-86328110 TCATGAAAGCCAGGATGTCAAGG + Intergenic
1141897807 16:86969835-86969857 GCTCCTAAGCCAGGATGCCTTGG - Intergenic
1142084963 16:88173286-88173308 CCATGCAAGCCAGAAGGCCATGG + Intergenic
1142123506 16:88398793-88398815 GGATCCCAGCCCGGATGCCCTGG - Intergenic
1142725963 17:1814268-1814290 GCATTCAAGCCTGGGTGACAGGG + Intronic
1145017776 17:19410364-19410386 GCAGCCAAGCCAGGGTGCAGAGG + Intergenic
1147864029 17:43541363-43541385 GCTGCCAAGCCAGTGTGCCAGGG + Intronic
1148449311 17:47764938-47764960 GCATTCCAGCCTGGATGACAAGG + Intergenic
1149299183 17:55288473-55288495 ACATTCAAGGCTGGATGCCATGG + Intronic
1150090567 17:62321285-62321307 GCATTCCAGCCTGGATGACAGGG + Intergenic
1151392198 17:73795006-73795028 ACATGCAAACCAGGAGGCCAAGG + Intergenic
1152118363 17:78402817-78402839 GCATCCAACTCAGGAAGACAGGG - Intronic
1156498333 18:37540694-37540716 GCATCTTTCCCAGGATGCCAAGG - Intronic
1157511470 18:48278468-48278490 GCATTCCAGCCTGGATGACAGGG - Intronic
1160060034 18:75521592-75521614 GCAGCCCAGGCAGGATACCAGGG - Intergenic
1160233298 18:77065614-77065636 GCACCAAAGCCTGGATACCACGG - Intronic
1160523705 18:79523251-79523273 GCTTCCAAGCCAGGCAGCAAGGG + Intronic
1161816853 19:6504480-6504502 GCACCCCAGCCTGGATGACAGGG - Intergenic
1162840591 19:13353679-13353701 GCATTTAAACCAGGAAGCCAAGG + Intronic
1162924244 19:13922034-13922056 GCATTCCAGCCTGGATGACAGGG - Intronic
1163345640 19:16740257-16740279 GCACCCAGGCCAGAGTGCCACGG - Intronic
1163464760 19:17460866-17460888 GCACCCAACCCAGGTTACCATGG - Exonic
1163700610 19:18784887-18784909 GCATCCAACTCAAGGTGCCAGGG - Exonic
1165024318 19:32948626-32948648 ACATCCCAGCCATGTTGCCAGGG + Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
927951250 2:27171080-27171102 GTAACCATGCCAAGATGCCAAGG - Intergenic
928163053 2:28946844-28946866 GCCTCTGTGCCAGGATGCCAAGG + Exonic
929827649 2:45321846-45321868 GCAGGCCAGCGAGGATGCCAAGG + Intergenic
930971219 2:57397743-57397765 GCAGGCAAGCCTGGATGCCATGG - Intergenic
932566336 2:72913419-72913441 GCATCCAAGTCTGGTTGCAAAGG + Intergenic
933646116 2:84813882-84813904 TCATCCAAACCAGGCTGCCCTGG - Intronic
936459835 2:112705361-112705383 GCATCCCAGCCAGGGTTGCAAGG - Intergenic
938237356 2:129717207-129717229 TCCCCCAAGCCAGGATCCCAAGG + Intergenic
943249289 2:185496206-185496228 GCAGCCTACCCAGGATGCCATGG - Intergenic
945425863 2:209700477-209700499 CCTTCCATGCCTGGATGCCACGG - Intronic
945876712 2:215285450-215285472 GCATCAAAGGCTGGATACCACGG - Intergenic
947809845 2:232997464-232997486 GCATCCAAGCCAGAACCCCCGGG + Intronic
948291097 2:236825484-236825506 GCAGCCCAGCCAGGAAACCAGGG - Intergenic
948554244 2:238796356-238796378 GCATCCCGGCCAGGATGGCAGGG - Intergenic
948697770 2:239741933-239741955 GCCTCCCAGGCAGGATTCCATGG - Intergenic
948853233 2:240718432-240718454 GCAGCCCAGCCAGGGTCCCAGGG - Intronic
948868222 2:240785885-240785907 GCATCCCAGGCAGGAGGCCCAGG + Intronic
1171771116 20:29324291-29324313 GCATCCAGGCCAGGGTGGCAGGG + Intergenic
1171781409 20:29421992-29422014 GCACCCCAGCCAGAATGACAGGG + Intergenic
1171798016 20:29581538-29581560 GCATCCAAGGAAGGACGCCTTGG - Intergenic
1171850225 20:30302623-30302645 GCATCCAAGGAAGGAGGCCTTGG + Intergenic
1171905418 20:30895273-30895295 GCATCCAGGCCAGGGTGGCAGGG - Intergenic
1172990802 20:39035104-39035126 GCATTCCAGCCAGGATGACAGGG - Intronic
1174795367 20:53517837-53517859 GCATCCCAGCCTGGGTGACAGGG - Intergenic
1175340689 20:58227509-58227531 ACATCCCCCCCAGGATGCCAGGG - Intronic
1180222222 21:46366201-46366223 GCATCCAACCAAGAATCCCAAGG - Intronic
1180316505 22:11282111-11282133 GCATCCAGGCCAGGGTAGCAGGG + Intergenic
1180338836 22:11601388-11601410 GCATCCAGGCCAGGGTGGCAGGG - Intergenic
1180487666 22:15817286-15817308 GCATCAAAGCCAGGCAGGCAGGG - Intergenic
1180765841 22:18345490-18345512 GCCTCCAGCCCAGGATGCCCTGG - Intergenic
1180780470 22:18516888-18516910 GCCTCCAGCCCAGGATGCCCTGG + Intronic
1180793042 22:18587580-18587602 GCAGCCTAGCCATGATGACAGGG + Intergenic
1180813188 22:18774209-18774231 GCCTCCAGCCCAGGATGCCCTGG + Intergenic
1181199363 22:21208525-21208547 GCCTCCAGCCCAGGATGCCCTGG + Intronic
1181228695 22:21407738-21407760 GCAGCCTAGCCATGATGACAGGG - Intergenic
1181249954 22:21527127-21527149 GCAGCCTAGCCATGATGACAGGG + Intergenic
1181400395 22:22647332-22647354 GCCTCCAGCCCAGGATGCCCTGG - Intronic
1181648970 22:24248459-24248481 GCCTCCAGCCCAGGATGCCCTGG + Intergenic
1181702374 22:24628430-24628452 GCCTCCAGCCCAGGATGCCCTGG - Intronic
1184077368 22:42190423-42190445 GCATTCCAGCCTGGATGACAGGG + Intronic
1184312889 22:43659623-43659645 GCATTCCAGCCAGGGTGCCAGGG + Intronic
1185032857 22:48453843-48453865 GGATCCAGGCCAGGAAGTCAGGG + Intergenic
1203227462 22_KI270731v1_random:86381-86403 GCCTCCAGCCCAGGATGCCCTGG - Intergenic
949507159 3:4738878-4738900 GGATCCATGCCAGGATGGAAGGG + Intronic
951895384 3:27605301-27605323 GCCTCCAAGTTAGGATGACAGGG + Intergenic
952234248 3:31462737-31462759 GCTTCCAATCCAGTTTGCCACGG - Intergenic
953231266 3:41066823-41066845 CCACCCAGGGCAGGATGCCACGG - Intergenic
954506244 3:51077248-51077270 TCCTCCAAGCCAGTATTCCAAGG - Intronic
954590987 3:51781394-51781416 CCTTCCAGGCCAGGTTGCCATGG + Intergenic
959038839 3:101397166-101397188 GCATCCTAGCCTGGGTGACAGGG - Intronic
959393455 3:105805335-105805357 GCATCCCAGCCTGGGTGACAGGG - Intronic
961269409 3:125677819-125677841 GCATCCAGGCCAGGGTGGCAGGG + Intergenic
961326403 3:126111883-126111905 TCATCCAGGCCATGATACCAGGG - Intronic
961852781 3:129838372-129838394 GCATTCCAGCCTGGATGACAGGG + Intronic
969168666 4:5340617-5340639 TCATCCAAGGCAGGATTCCTTGG + Intronic
970010286 4:11451020-11451042 ACATCCAAACAAGGATGTCAAGG - Intergenic
970727246 4:19060828-19060850 GCCTCCCAGTCAGGAGGCCAGGG - Intergenic
973175199 4:47197067-47197089 GAATCCTGGCCAGGAGGCCATGG - Intronic
977054646 4:92176100-92176122 GAATTGAAGCCAGCATGCCATGG - Intergenic
980000782 4:127485152-127485174 GCAACCAGGGCAGGATGCCAAGG - Intergenic
982212104 4:153046227-153046249 GCATGTCAGCAAGGATGCCAGGG - Intergenic
985447409 4:190032335-190032357 GCACCCCAGCCAGAATGACAGGG + Intergenic
986468871 5:8053515-8053537 GCATCCAGGCCTGGGTCCCAGGG - Intergenic
986694647 5:10340754-10340776 CCATCCAACCAAGGAGGCCAGGG - Intergenic
987049927 5:14140676-14140698 GCAATCCAGGCAGGATGCCAGGG + Intergenic
988139375 5:27216641-27216663 GCTTCCAAGCTTGGATCCCAAGG + Intergenic
991343844 5:65641674-65641696 GCATCCTAGCCTGGATGACAGGG + Intronic
994196673 5:96930056-96930078 TCATTCATGACAGGATGCCAGGG + Intronic
995559832 5:113368836-113368858 GCATCTAAGGCAGGGTGGCAGGG - Intronic
996686302 5:126285032-126285054 GCAGCCAAACCAGGATGCAGTGG - Intergenic
996900893 5:128539384-128539406 GGGTCCAAGCCAGGAAGCAAGGG - Intronic
997364139 5:133314634-133314656 GCATGCAAGTCAGCCTGCCAGGG + Intronic
997817508 5:137033249-137033271 GCATGGAAGCCTGGATGCTATGG + Intronic
1001738781 5:174031928-174031950 GCATCCCAGGGAGGAAGCCATGG + Intergenic
1001881700 5:175250173-175250195 TCCTCCAAGCAAGGATGCCATGG - Intergenic
1002821972 6:734410-734432 GCAGCGCAGCCAGGAAGCCAGGG + Intergenic
1003538704 6:6999545-6999567 TCACCCAGGCTAGGATGCCATGG - Intergenic
1003628969 6:7769350-7769372 CCATCCAAATCAGGATGCCTGGG + Intronic
1006044156 6:31280355-31280377 GCTTCCAAGGCAGGAAGCCGAGG - Intronic
1006125602 6:31835871-31835893 GCATTCCAGCCAGGGTGACAGGG - Intronic
1006753382 6:36393684-36393706 TCATCCAGGCTAGAATGCCATGG - Intronic
1007064563 6:38977000-38977022 CCACCCAAACCAGGATTCCAAGG - Intronic
1007253094 6:40509793-40509815 GCATGCGTGCCAGTATGCCAGGG + Intronic
1007253110 6:40509903-40509925 GCATGCATGCCAGTATGCCAGGG + Intronic
1008118041 6:47576107-47576129 GCATTCCAGCCTGGATGACATGG - Intronic
1008562687 6:52737632-52737654 GCAGCCAAGCAAGGAGCCCAAGG - Intergenic
1010410184 6:75552592-75552614 GCACTCAAGCCTGGATGACAGGG - Intergenic
1012985096 6:105867271-105867293 AAATCCAATCCAGAATGCCAAGG + Intergenic
1014404632 6:121036250-121036272 TCATCCAGGCTAGAATGCCATGG + Intergenic
1014578333 6:123102353-123102375 GGATCAAAGCCAGAATGCCTTGG - Intergenic
1016041915 6:139440539-139440561 ACTTCTGAGCCAGGATGCCAAGG - Intergenic
1017375260 6:153761029-153761051 GCATCCATGCCATGCTCCCATGG - Intergenic
1017512959 6:155130347-155130369 CCCTCAAAGCCAGGATGCGACGG + Exonic
1019661554 7:2226950-2226972 GCATTCCAGCCTGGATGACAGGG + Intronic
1019739025 7:2663651-2663673 GCACCCACGCCAGGGTGCCAGGG - Exonic
1020069536 7:5217258-5217280 TGAGCCAAGTCAGGATGCCAGGG - Intronic
1020521191 7:9189576-9189598 GAATCTCAGCCAGGATCCCAAGG - Intergenic
1020718298 7:11707381-11707403 GCATACTAGGCAGGATGCCATGG - Intronic
1020787153 7:12587658-12587680 GCATCCAAGCCACTGGGCCAAGG - Intronic
1021484856 7:21156763-21156785 GAATCCATTCCTGGATGCCATGG + Intergenic
1023528644 7:41130960-41130982 GGTTCAAAGCCAGGAGGCCAAGG - Intergenic
1023532760 7:41175509-41175531 GCATCCCAGCCAGGATGACACGG - Intergenic
1023708259 7:42965006-42965028 GGATCCAAGTCAGGATGACAGGG - Intergenic
1023864112 7:44230753-44230775 GCATCCAAGTGAGGAAGCCACGG - Intronic
1027180795 7:75937955-75937977 GCATTCAAGCCAAGGAGCCAAGG + Intronic
1028611943 7:92721365-92721387 GCACACAACCCAGGGTGCCAAGG - Intronic
1030006617 7:105126603-105126625 GCATTCAAGCCAGAATTCCTGGG + Intronic
1030473620 7:109999564-109999586 GCTTCCAAGGCAGGAAGCCTAGG + Intergenic
1032081147 7:128859075-128859097 CCACCCAAGCCAGGCTCCCAGGG + Exonic
1032724546 7:134578412-134578434 GCATTCAAGCAAGAAGGCCAGGG + Intronic
1033142306 7:138838416-138838438 GGATCCATGCCAGGCTGACAAGG + Intronic
1033301258 7:140188268-140188290 GTCTCCAAGACAGGATGTCATGG + Intergenic
1034969886 7:155412384-155412406 GCATCCAAGGAGGGATGCCCAGG - Intergenic
1035881449 8:3247532-3247554 CCATCTGGGCCAGGATGCCAGGG + Intronic
1038353999 8:26809505-26809527 GCCTCCAAGGCAGGATGTCATGG - Intronic
1039764509 8:40613817-40613839 GCATCCAAGCCAGCCTCCAAAGG + Intronic
1042283016 8:67075626-67075648 GCACTGAAGCCAGGCTGCCAGGG - Intronic
1048035549 8:130673967-130673989 CCATCCCAGCCAGGAGTCCAGGG - Intergenic
1049423586 8:142527355-142527377 GCATCCAAGCAAGACTGGCACGG - Intronic
1049433749 8:142576905-142576927 GCCTGCAAGCCTGGATGCCCTGG + Intergenic
1050439277 9:5643471-5643493 GCAACCCAGCCAGGATGACAGGG + Intronic
1050612570 9:7368434-7368456 GCTTCCAAGCCAAGATTTCAAGG + Intergenic
1050641808 9:7676419-7676441 GTATCCAAGTGAGGATGACATGG + Intergenic
1053219692 9:36301786-36301808 GCATCTCAGCCATGTTGCCAAGG + Intronic
1053788003 9:41665916-41665938 GCATCCAAGGAAGGAGGCCTTGG + Intergenic
1054157129 9:61648852-61648874 GCATCCAAGGAAGGAGGCCTTGG - Intergenic
1054176279 9:61877258-61877280 GCATCCAAGGAAGGAGGCCTTGG + Intergenic
1054476904 9:65579857-65579879 GCATCCAAGGAAGGAGGCCTTGG - Intergenic
1054661260 9:67703550-67703572 GCATCCAAGGAAGGAGGCCTTGG - Intergenic
1057553302 9:96067607-96067629 GCACCCCAGCCAGCATGCCCAGG + Intergenic
1058991804 9:110260989-110261011 GCAGCCTAACCAGGGTGCCAGGG + Intergenic
1059425096 9:114216053-114216075 ACATCCAAAGCAGGATGCCAAGG - Intronic
1061036528 9:128117431-128117453 GGCCCCAAGCCAGGATTCCATGG - Intergenic
1061046316 9:128166993-128167015 GCTTCCCAGCCAGAATGCCATGG + Intronic
1061140390 9:128762789-128762811 GCACAAAAGCCAGGATGCCTGGG + Intronic
1061551328 9:131336456-131336478 GCATCCAACTCAGGTGGCCAGGG + Intergenic
1061879447 9:133561416-133561438 GCCCCCAAGTCAGGAGGCCACGG - Intronic
1203441161 Un_GL000219v1:9849-9871 GCACCCCAGCCAGAATGACAGGG + Intergenic
1203364806 Un_KI270442v1:248059-248081 GCATCCAGGCCAGGGTAGCAGGG + Intergenic
1203511970 Un_KI270741v1:128757-128779 GCACCCCAGCCAGAATGACAGGG + Intergenic
1185504770 X:624125-624147 GCAGACGAGCCAGGATCCCAGGG - Intergenic
1186126380 X:6418984-6419006 CCAGCCAAGCCTGGATGCCCTGG - Intergenic
1186304777 X:8244503-8244525 GCATCTAAGCATGGATTCCAGGG - Intergenic
1186316509 X:8376089-8376111 GCATTCCAGCCTGGATGACAGGG + Intergenic
1188390079 X:29609065-29609087 CCATCCAAACCATGATTCCAAGG - Intronic
1189165740 X:38859156-38859178 GCATCCAAGCCACCTTGCTATGG + Intergenic
1193265596 X:79464493-79464515 GCACCCATGCCAGGCTTCCACGG - Intergenic
1193508794 X:82373567-82373589 GCATACATGGCAGGATCCCAAGG - Intergenic
1196141173 X:112265139-112265161 GCCACCAGGCCAGGAGGCCAAGG + Intergenic
1196726193 X:118898026-118898048 GCACTCAAGCCCGGATGACAAGG - Intergenic
1200138826 X:153887259-153887281 GCATCCAAGCCAGGATGCCAGGG - Intronic
1201073927 Y:10172427-10172449 GTATCCATGCCAGGGTGGCAGGG - Intergenic
1201598910 Y:15705788-15705810 GCATACTAGCCAGGTTGGCATGG + Intergenic