ID: 1200138851

View in Genome Browser
Species Human (GRCh38)
Location X:153887339-153887361
Sequence ATCTGTGCTCAGAGAGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 234}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200138834_1200138851 28 Left 1200138834 X:153887288-153887310 CCCATAGTGCCAGCTTCAGTTCC 0: 1
1: 0
2: 0
3: 15
4: 148
Right 1200138851 X:153887339-153887361 ATCTGTGCTCAGAGAGGGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 234
1200138844_1200138851 6 Left 1200138844 X:153887310-153887332 CCCTGGAATGGGAAGCTTGGGGT 0: 1
1: 0
2: 4
3: 58
4: 243
Right 1200138851 X:153887339-153887361 ATCTGTGCTCAGAGAGGGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 234
1200138845_1200138851 5 Left 1200138845 X:153887311-153887333 CCTGGAATGGGAAGCTTGGGGTG 0: 1
1: 0
2: 0
3: 30
4: 376
Right 1200138851 X:153887339-153887361 ATCTGTGCTCAGAGAGGGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 234
1200138832_1200138851 30 Left 1200138832 X:153887286-153887308 CCCCCATAGTGCCAGCTTCAGTT 0: 1
1: 0
2: 0
3: 2
4: 134
Right 1200138851 X:153887339-153887361 ATCTGTGCTCAGAGAGGGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 234
1200138835_1200138851 27 Left 1200138835 X:153887289-153887311 CCATAGTGCCAGCTTCAGTTCCC 0: 1
1: 0
2: 0
3: 11
4: 199
Right 1200138851 X:153887339-153887361 ATCTGTGCTCAGAGAGGGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 234
1200138837_1200138851 19 Left 1200138837 X:153887297-153887319 CCAGCTTCAGTTCCCCTGGAATG 0: 1
1: 0
2: 2
3: 15
4: 146
Right 1200138851 X:153887339-153887361 ATCTGTGCTCAGAGAGGGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 234
1200138833_1200138851 29 Left 1200138833 X:153887287-153887309 CCCCATAGTGCCAGCTTCAGTTC 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1200138851 X:153887339-153887361 ATCTGTGCTCAGAGAGGGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 234
1200138842_1200138851 7 Left 1200138842 X:153887309-153887331 CCCCTGGAATGGGAAGCTTGGGG 0: 1
1: 0
2: 2
3: 19
4: 190
Right 1200138851 X:153887339-153887361 ATCTGTGCTCAGAGAGGGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200138851 Original CRISPR ATCTGTGCTCAGAGAGGGTC TGG Intronic
904465769 1:30706800-30706822 AACAGAGCTCAGAGAGGGTCAGG + Intergenic
904770928 1:32881092-32881114 ATTAGGGCTGAGAGAGGGTCAGG + Intergenic
905854047 1:41295592-41295614 TTCTGTGCTCAGAGAGCATCAGG - Intergenic
905984577 1:42267338-42267360 ATTTGTGCTTGGAGAGGGTGCGG - Intronic
906225263 1:44116865-44116887 AATTATGCTCAGAGAAGGTCAGG - Intergenic
907385143 1:54121271-54121293 GTCTGGGGTCAGAGAGGGCCCGG - Intergenic
907928633 1:58978536-58978558 CTCTGTGCTCAGAGGAGGTAAGG - Intergenic
911092084 1:94025542-94025564 AGGTGAGCTCAGAGAGGGGCAGG - Intronic
911586250 1:99694768-99694790 ATCTGTGCTCTTTGAGGGTATGG - Intergenic
915163032 1:153933029-153933051 ATCTGTGGGCAGGGAGAGTCGGG + Exonic
917234236 1:172873283-172873305 TTCTGTCCACTGAGAGGGTCTGG - Intergenic
917516854 1:175715472-175715494 ATCTGTGCACATAGCTGGTCAGG - Intronic
918194195 1:182206603-182206625 ATCTGTGCTCAGGGAGGAAAAGG + Intergenic
919100989 1:193097473-193097495 ATCTATCCTCAGAGAATGTCTGG + Intronic
919784276 1:201249298-201249320 AGCTGCGCTCAGAGAGGTACAGG - Intergenic
924322757 1:242865981-242866003 ATTTGTGCTCAGAGTGATTCCGG - Intergenic
1063368106 10:5503714-5503736 CCCTGTCCTCAGAGAAGGTCAGG - Intergenic
1063546525 10:6987174-6987196 CTCTGTGATCAGAGACGGCCAGG + Intergenic
1065303275 10:24344674-24344696 ATCTGTGCTTAAACATGGTCAGG + Intronic
1067017927 10:42771640-42771662 AGCTGTGCCCAGAGTGGGTGTGG - Intergenic
1069227998 10:65968550-65968572 ATCTATGCACAGAAAGGGTAGGG - Intronic
1069606282 10:69740764-69740786 ATCTGTGCAAGGAGAGGATCTGG + Intergenic
1071256330 10:83875221-83875243 TTCTTTTCTCAGAGAGGGCCTGG + Intergenic
1073420642 10:103421209-103421231 AGCTGTGTTCAGAGAGGGCTTGG + Intronic
1074545734 10:114401003-114401025 ATCTGTGGTCAGGGAAGGTCTGG - Intronic
1075180195 10:120204382-120204404 ATCTCTGCACAGAAAGGGTGGGG + Intergenic
1075387124 10:122062946-122062968 ATCAGGGCTCAGAGAGGTTAAGG + Intronic
1076605835 10:131689361-131689383 ATCTGTGCTCAGATGGTCTCGGG + Intergenic
1076685018 10:132194611-132194633 TTCTGTGCTCAGAGGGTGGCTGG + Intronic
1076691736 10:132227134-132227156 ATCTGGGCTCAGAGCTGCTCTGG - Intronic
1076984098 11:223080-223102 ACCTGTGCTCAGAGGGGCCCAGG - Intronic
1077132580 11:980606-980628 ATCTGTTCTCACTGAGGGCCAGG + Intronic
1077746963 11:4917058-4917080 ATATGAGCTCAAAGAGGGTAGGG + Intronic
1077888800 11:6404551-6404573 ATCTGTGTGCAGCAAGGGTCAGG - Intronic
1078547161 11:12254743-12254765 ATCTGTGCAATGAGAGGCTCAGG + Intronic
1080823145 11:35826050-35826072 ATCAGTGCTTTGAGAGGCTCAGG - Intergenic
1083161555 11:60857548-60857570 GTCTGCGCACAGAGAGTGTCAGG + Intergenic
1083615131 11:64022356-64022378 ATCTGAGCTCGGGGAGGGTGAGG - Intronic
1085282712 11:75341459-75341481 TTCTGTGGGCAGAGAGGGTAAGG - Intronic
1085308835 11:75504053-75504075 ACCTGTGCACAGAGAGGGGCAGG - Intronic
1086412636 11:86557888-86557910 ATCTGTGCTGGGTGAGGGGCGGG - Intronic
1088285173 11:108180242-108180264 ACCTGAGCTCAAAGAGGTTCAGG + Intronic
1088425429 11:109696668-109696690 ATCTGTGCACAGGAAGGGTGGGG - Intergenic
1088648344 11:111936181-111936203 ATTAGGGCTCAGAGAAGGTCAGG - Intronic
1088719901 11:112583115-112583137 ATCTGGGCTCAGCTGGGGTCAGG - Intergenic
1089384637 11:118059751-118059773 ATCTGGGCTCAGAGTGAGGCAGG - Intergenic
1091837871 12:3598467-3598489 CTCTGTGCTCAGGGAAGGACTGG + Intergenic
1091983222 12:4883539-4883561 CCCTGTGCTCAGAAAGGGACAGG - Intergenic
1094473625 12:30824964-30824986 ATTTATGCACAGAGAAGGTCAGG - Intergenic
1095324857 12:40877186-40877208 CTCTGGGCTCAGTGAAGGTCAGG + Intronic
1096223406 12:49847381-49847403 AGGTGTGATCAGAGAGGGACAGG - Intergenic
1101437374 12:104675892-104675914 ATTTGTGCTCGGAGAAGGTGGGG + Intronic
1104200953 12:126588422-126588444 AGCTGAGCTCTGAGAGGGTAGGG - Intergenic
1105594619 13:21825363-21825385 ATCTGTGTTTAGAGAGCGTGTGG - Intergenic
1107281336 13:38738741-38738763 CTCTGTGCTCAGAGATAGGCTGG - Intronic
1107540826 13:41387583-41387605 ATCTCTGCTCCTGGAGGGTCTGG - Intergenic
1109309173 13:60672104-60672126 ATCTATGCCCAGAAAGGGTGGGG + Intergenic
1110638271 13:77791296-77791318 ATCTCTGCACAGAAAGGGTGTGG - Intergenic
1111987299 13:95078112-95078134 ATCTATGCTCAGGGAAGGTCTGG - Intronic
1113737058 13:112686482-112686504 AGCTGTGCTCGCAGTGGGTCAGG + Intergenic
1116012770 14:39370271-39370293 ATCTCTGCTCAGTGAGGACCTGG + Intronic
1116581344 14:46645896-46645918 ATCTGCTTTCAGAGAGGGACAGG - Intergenic
1117929932 14:60831012-60831034 ATTTTTGCTGAGAGAGTGTCTGG + Intronic
1118369598 14:65126151-65126173 GTCTATCCTCTGAGAGGGTCTGG + Intergenic
1118439628 14:65800754-65800776 AGCTGTGATCAGAGACGGGCGGG - Intergenic
1121313326 14:92946765-92946787 ACCGGAGCTCAGAGAGGGTTGGG + Intronic
1122836191 14:104432223-104432245 ACCTGGGCTCAGGGAGGGCCAGG + Intergenic
1124603352 15:31152251-31152273 ATCTGTGCCCATAGAGGGTTGGG - Intronic
1125371651 15:38984045-38984067 ATCTGTGCACAGGAAGGGTGGGG + Intergenic
1128245638 15:66130857-66130879 ATCTGTCCTCAGAGAGATCCTGG - Intronic
1128618448 15:69128716-69128738 ATCTGATCTCTGAGAGGGACAGG + Intergenic
1135042911 16:19131676-19131698 CTCTGTGTTTAGAGAGAGTCAGG + Intronic
1135664878 16:24327188-24327210 ACTTGGGCTCAGAGAGGCTCTGG + Intronic
1136247184 16:28982836-28982858 ATCTGGGGGAAGAGAGGGTCGGG - Exonic
1137729440 16:50679245-50679267 ATCTGTGCTCAGGGGGTGCCAGG - Intronic
1138990572 16:62386200-62386222 ATATTTGGTCAGCGAGGGTCAGG + Intergenic
1140771744 16:78211899-78211921 AACTCAGCTCAGAGAGGGTAGGG - Intronic
1142649559 17:1339071-1339093 CTCAGTGCTCAGAGAGGCTGAGG + Intergenic
1143120533 17:4603812-4603834 ATCTGAGTTCAGAGAGGCTGGGG - Intronic
1144764717 17:17726110-17726132 ATGAGAGCCCAGAGAGGGTCAGG + Intronic
1145057834 17:19714852-19714874 ATCTGGGCTGAGCCAGGGTCAGG + Intronic
1145254459 17:21315025-21315047 ATCTCTGCTCAGAGAAGTGCAGG + Exonic
1146061713 17:29611376-29611398 AGCTGTGCTCACAGAGGCCCTGG + Intronic
1146608571 17:34284903-34284925 ATGTGTGCTCAGAGAGTGAGGGG + Intergenic
1146887409 17:36481918-36481940 AACTCTGCTCAGTGAGGGGCGGG - Intergenic
1147427897 17:40355036-40355058 AACTGGGCTCAGGGAGGGTTTGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150247854 17:63689604-63689626 ATTTGTGCTCAGGGAGCGGCTGG - Exonic
1151752794 17:76050469-76050491 ATCAATGCTCAGCGAGTGTCGGG - Exonic
1152164356 17:78692569-78692591 CTCTCTTCTCAGAGAGGGTTGGG + Intronic
1152647684 17:81477323-81477345 CTCTGTGCTGTGAGAGGGGCTGG - Intergenic
1152737780 17:82005722-82005744 CTCTGTGCTGAGTGAGGTTCGGG - Intronic
1154038288 18:10828587-10828609 ATTGGTGCCCAGAGAGGGTCCGG + Intronic
1154134173 18:11761351-11761373 ACCTGTGCTCTGAGAGGGCATGG - Intronic
1155676894 18:28440694-28440716 ATCTCTGCACAGAAAGAGTCGGG + Intergenic
1158411133 18:57206940-57206962 GTCTGTGCTCAAAGACAGTCAGG + Intergenic
1158415955 18:57249986-57250008 ATGTGTGCTCAGAGAGAGCGGGG + Intergenic
1160856643 19:1220820-1220842 GGCTGTGGCCAGAGAGGGTCTGG - Intronic
1161296772 19:3524121-3524143 CTGTGTGCACAGAGAGGATCTGG + Intronic
1161713501 19:5863205-5863227 AGCCCTGCTCAGAGAGGGCCAGG - Intergenic
1161898933 19:7103371-7103393 ATCTGTGATCAGAAAGGGAGTGG - Intergenic
1162870679 19:13584222-13584244 TTCAGTGCTCAGAGAGGCTGTGG + Intronic
1163490971 19:17616952-17616974 GTGTGCGCTCAGAGAGGGACAGG + Intronic
1163646098 19:18489935-18489957 ATCTCTGCTCAGTGCGCGTCTGG - Intronic
1164721749 19:30437677-30437699 CCCTGTGCTCAGAAAAGGTCAGG + Intronic
1165242616 19:34480781-34480803 ATCTCTGAGCAGAGAGGGCCTGG + Intergenic
1165711717 19:38015962-38015984 ATCTGCGCTCACAGGGGATCAGG + Intronic
1166448635 19:42879629-42879651 AGCCGTGCTCAGAGAGTTTCTGG - Exonic
1166721604 19:45000230-45000252 ATCTGTGGTCTGAGAGCGCCTGG + Intergenic
1167619588 19:50553326-50553348 ATCTCTGCTCTGAGTGGGACGGG - Intronic
1168311853 19:55464611-55464633 ATCTGTGAGCAGGGAGGGGCAGG + Intergenic
927514952 2:23666817-23666839 AGCTGTGACCACAGAGGGTCGGG - Intronic
927642724 2:24855619-24855641 TTCTTTTCCCAGAGAGGGTCAGG - Intronic
927690840 2:25207125-25207147 GACTGTGCTCAGGGAGGGCCTGG - Intergenic
927917352 2:26945654-26945676 AACTGTGCTCAGGGAGACTCAGG - Intronic
928233498 2:29520569-29520591 AGCTCTGCTCACAGAAGGTCTGG + Intronic
930373379 2:50533127-50533149 CTCAGTGCTTAGAGAGGTTCTGG - Intronic
930892711 2:56409711-56409733 TTCTGTGCTCAGAGTGGATCAGG - Intergenic
931808085 2:65827455-65827477 ATCTGTGCTGAGTGATGGTGGGG + Intergenic
932236320 2:70123883-70123905 ACCTGTGCCCAGAGAGGGCGAGG + Intergenic
932481644 2:72043032-72043054 AATTGGGCTCTGAGAGGGTCAGG - Intergenic
934618819 2:95791847-95791869 ATCTGTGCTAGGAGATGGCCGGG + Intergenic
934642074 2:96032710-96032732 ATCTGTGCTAGGAGATGGCCGGG - Intronic
934709912 2:96508148-96508170 ACCTTTGCTCTGAGAGGGGCGGG + Intergenic
934965098 2:98714558-98714580 CTCTGTGCACTGAGAGGGACTGG + Intronic
938241803 2:129748061-129748083 ATCTCTGCTCAGGAAGGGTGGGG - Intergenic
939569592 2:143824923-143824945 ATCAGTGCTTAGAGAGAATCAGG - Intergenic
940308271 2:152249663-152249685 ATCTGTTCACAGAAAGGTTCTGG - Intergenic
940868474 2:158839638-158839660 GCCTGTCCTCAGAGAGGCTCTGG - Intronic
941562790 2:167069645-167069667 TTCTGTGGTAGGAGAGGGTCGGG - Intronic
948079979 2:235198099-235198121 GGCTGTGCTCAGTGAGTGTCTGG + Intergenic
948370961 2:237488750-237488772 ATGTGTGCCCAGTGAGGGGCTGG + Intronic
948503022 2:238408624-238408646 GTCTGTTCTCAAAGAGGGGCAGG - Intergenic
948522925 2:238552477-238552499 ATCTGTCCTCAGAGAGACTGCGG - Intergenic
1169591834 20:7151850-7151872 ATCCGTGCTCACAGAGGGAGAGG - Intergenic
1170197004 20:13699594-13699616 ATCAGTGCTCAGGAAGGGACTGG - Intergenic
1170534514 20:17326819-17326841 AGACGTGCTCAGAGAGGGACTGG + Intronic
1175645157 20:60664717-60664739 GACTGTGGTCAGAGAGGGGCTGG - Intergenic
1177486810 21:21768792-21768814 TTCTGTGCTCAGATAGAGACTGG - Intergenic
1178156169 21:29856590-29856612 ATCGGTGCTTAGACAGTGTCTGG - Intronic
1182048767 22:27297544-27297566 ATCTAGGCTCTGAGAGGCTCAGG + Intergenic
1182058234 22:27378056-27378078 AACTGGGCTCAGAGAGGTCCTGG + Intergenic
1182295004 22:29307272-29307294 CTCTGGGCCCAGAGAGGGTGCGG - Intronic
1182856909 22:33525683-33525705 ATGAGTGCTCAGAGAGGCTACGG + Intronic
1183569057 22:38638486-38638508 GTCTCTGCTCAGAGATGTTCAGG - Intronic
1183639455 22:39084169-39084191 TGCTGTGCTCTGAGAGGGTCAGG + Intronic
1184076215 22:42180104-42180126 ATCTGGGGTAAGAGAGGGTAAGG + Intronic
1184260937 22:43315729-43315751 ATCTGTGCTCAGAGGTGGTGGGG + Intronic
1184736118 22:46398636-46398658 TTCTGTGCGGAGAGAGGGGCCGG + Exonic
949937198 3:9125031-9125053 GGCTGGGCTCAGAGAGGCTCTGG - Intronic
950139974 3:10608755-10608777 AGGTGTGATAAGAGAGGGTCTGG - Intronic
950533560 3:13566943-13566965 ACCAGGGCTCAGAGAGGGCCAGG + Intronic
951194030 3:19804116-19804138 ATCTCTGCACAGAGAGGATGGGG - Intergenic
951529573 3:23686021-23686043 ATCTGATCCCAGAGAGGATCGGG - Intergenic
954697445 3:52435323-52435345 ATTTGTTCTCAGAGATGGCCTGG - Exonic
955109515 3:55934119-55934141 ATGTGTGCTCAATGAGGGTATGG + Intronic
955436069 3:58899920-58899942 ATCTGTGGGGAGAGAGGGCCAGG - Intronic
955867840 3:63403858-63403880 AACTGTGCACTGAGAGGCTCTGG + Intronic
956237518 3:67090774-67090796 AAGTGTGCTCAGAGAGGCTCAGG - Intergenic
959067069 3:101668383-101668405 ATCAGTGCTTTGAGAGGGTGAGG + Intronic
961499289 3:127320034-127320056 ATCTTTGTTCACAGAGGGTCAGG - Intergenic
965940140 3:174169442-174169464 ATCTGTGCACAGTAAGGGTGAGG + Intronic
969308475 4:6338881-6338903 AGCTGGGCTCAGAGAGGACCAGG - Intronic
969345004 4:6564595-6564617 TTCTGTGCTCAGTTAGGGTGAGG - Intergenic
969480016 4:7442282-7442304 ATCTGGGCTCAGGGAGGGGGTGG - Intronic
969629077 4:8324912-8324934 AGATGTGCTCAGAGAGGTTAAGG + Intergenic
969695206 4:8730329-8730351 CTCTGTGATCAGAGAGAGGCCGG + Intergenic
969818782 4:9705347-9705369 ATCTGAGCTCAGGGAATGTCAGG - Intergenic
970437705 4:16051520-16051542 TTCCGTGCTCAGAGAGGGCTTGG - Intronic
970446061 4:16124232-16124254 TTTTTTGCTCAGTGAGGGTCGGG + Intergenic
973696725 4:53497550-53497572 CTCTGGGCCCAGAGAAGGTCAGG + Intronic
976115570 4:81722556-81722578 GTCTGTGTTCAGGGAGGGTAGGG - Intronic
976753600 4:88475820-88475842 ATCTGTGGTCAGAAAGGAACAGG - Exonic
979913830 4:126405136-126405158 ATCTCTGCACAGAAAGGGTCAGG - Intergenic
980023850 4:127740845-127740867 ATCTCTGCACAGAAAGGGTAGGG + Intronic
982211339 4:153039133-153039155 ATTTGTCCACAGAGAGTGTCAGG + Intergenic
982647023 4:158037173-158037195 ATCTGTGCACAGGAAGGGTGGGG - Intergenic
985573762 5:664317-664339 CTATGTTCTCAGAGCGGGTCTGG - Exonic
988491368 5:31708209-31708231 ATATGTGCTCAGAGGCGGGCAGG - Intronic
990375506 5:55166525-55166547 ATGTGTGCTGAGAGAGGGAGCGG + Intronic
990782877 5:59385967-59385989 AAATGTTCTCAGAAAGGGTCAGG - Intronic
995148247 5:108810863-108810885 ATCTTTGCACAGAAAGGGTAGGG + Intronic
997349747 5:133222149-133222171 GTCTGTGCTGAGACAGGCTCTGG + Intronic
997355547 5:133260582-133260604 AGCCGTGCTTAGAGAGGGGCCGG - Intronic
997851361 5:137335700-137335722 ATGTGTCCCCAGAAAGGGTCAGG + Intronic
998127748 5:139635754-139635776 ATCTGGGCACAGAGAGGTTGGGG + Intergenic
998847883 5:146328481-146328503 ATCAGTGGTCAGGGAAGGTCAGG + Intronic
999155681 5:149455933-149455955 ATCTGTGCTCAGTGAAGGGGAGG - Intergenic
999248444 5:150167519-150167541 ATCTGTACAGAGAGAGGGTTAGG - Intronic
999313669 5:150569972-150569994 ATCTGTGATCAGAGAGTATGTGG - Intergenic
1000976111 5:167766169-167766191 ATTTAAGCTCAGAGAGGGTGAGG + Intronic
1002305883 5:178282616-178282638 ATCTGAGCTCAGAGGGTGACAGG - Intronic
1003163715 6:3658023-3658045 AACTGTGCTCAGAGCTGGTCAGG + Intergenic
1005828987 6:29655546-29655568 ATGTGGGAGCAGAGAGGGTCAGG - Intergenic
1007687604 6:43676249-43676271 ATGTCTGCTCAGATAGGGTTAGG + Intronic
1008234314 6:49025843-49025865 ATCTCTGCACAGAAAGGGTGGGG + Intergenic
1008964067 6:57296693-57296715 ATCTGTATGCAGAGAGGGCCTGG + Intergenic
1011196883 6:84790124-84790146 AACTGTGCTCAGAGAGTAACTGG - Intergenic
1011628416 6:89302051-89302073 ATCTTTGGTCAGAGTGGGGCCGG + Intronic
1013692990 6:112667626-112667648 AGCTGTGCCCAGAGTGGGTGAGG - Intergenic
1013952383 6:115798749-115798771 ATTCCTGCTCAGAGAGAGTCTGG - Intergenic
1017028179 6:150198645-150198667 ATCTGTTCTCAGAGGGGCTCAGG + Intronic
1017237661 6:152133686-152133708 AACTGAGATCAGAGACGGTCAGG - Intronic
1020193154 7:6016039-6016061 GCCTGTGATCAGAGAGAGTCCGG - Intronic
1021913355 7:25408037-25408059 TTCTCTTCTCAGAGAGGGACAGG - Intergenic
1022223704 7:28340946-28340968 ATCTGTGCAGAGAGAGAATCTGG - Intronic
1023994126 7:45148484-45148506 ACCTGAGCTCAGAGAGAGGCGGG - Intergenic
1024046852 7:45590942-45590964 AGCTGTGCTGGGCGAGGGTCAGG + Intronic
1024085043 7:45885537-45885559 ATCTGTGTTGACAGAGGGTCAGG + Intergenic
1024943036 7:54781961-54781983 AGCTGGGCTCAGTGGGGGTCTGG + Intergenic
1026258839 7:68736621-68736643 ATCTGTGCACAGACAGGGGTGGG - Intergenic
1027160678 7:75800093-75800115 GGCTGTGGTCAGGGAGGGTCTGG - Intergenic
1027808711 7:82864382-82864404 ATCTGGGATCAGAGTGGGGCTGG + Intronic
1028621107 7:92830596-92830618 ATATTTGCTCAGACAGGGTCAGG - Intronic
1028857669 7:95610081-95610103 ATTTGTGCTCTGAGAGGATGGGG + Intergenic
1028984998 7:97002647-97002669 GTCTGAGCTCAGAGACAGTCAGG - Intergenic
1029505254 7:100960010-100960032 AGCTGTGGTCAGAGAGGAGCTGG - Exonic
1030407589 7:109133542-109133564 ATCTATGCCCAGAAAGGGTGGGG - Intergenic
1030616744 7:111745356-111745378 TTCTGTGCTCAGAAAAGTTCAGG - Intronic
1031493108 7:122413252-122413274 ATATCTGGTCAGAGATGGTCTGG + Intronic
1031893888 7:127325710-127325732 TCCTGTGCTCAGAGAGCCTCAGG + Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1034139415 7:148802216-148802238 ATCCGTGCCAGGAGAGGGTCGGG - Intergenic
1040362752 8:46683325-46683347 CTCTGTGATCATAAAGGGTCTGG - Intergenic
1040548808 8:48422780-48422802 ATCTGTACTCAAAGAAGGTATGG + Intergenic
1041870916 8:62633668-62633690 ATCTGTGCTCAAAGATGAGCTGG - Intronic
1044000593 8:86874920-86874942 ATCTGTCCACTGAGAGGGCCTGG - Intronic
1046606309 8:116375339-116375361 ATCTGTGCACAGGAAGGGTAGGG + Intergenic
1047112981 8:121811535-121811557 ATGTGGGCTCAGAGAAGGGCTGG + Intergenic
1047138569 8:122108753-122108775 ATCTGTGTTCACAGAGTGGCTGG - Intergenic
1048853716 8:138669006-138669028 CTCTGTGCTCAGAGAGCAGCAGG + Intronic
1049439297 8:142601896-142601918 CTCTGTCCTCAGGGAGCGTCAGG + Intergenic
1049646681 8:143738805-143738827 GTCTGTGGCCAGGGAGGGTCTGG - Intergenic
1050404342 9:5292367-5292389 ACATGGGCTCAGACAGGGTCTGG + Intergenic
1052981585 9:34454046-34454068 ATCTGTGCTCAGAAACACTCAGG + Intronic
1053290965 9:36879462-36879484 ATCTGTGATGACAGAGGGACAGG - Intronic
1053311143 9:37020880-37020902 ATTTGTGATCAGAGGGGCTCTGG - Intronic
1053315300 9:37046042-37046064 ATTTGTGCTCAGTGAGGGAAAGG - Intergenic
1056448023 9:86685462-86685484 ATCTGTGATCTGAGAGGGGTGGG - Intergenic
1056472011 9:86914695-86914717 ATCAGTGTTCAGAGATGGACAGG + Intergenic
1057254537 9:93534324-93534346 TGGTGTGCTCAGAGAAGGTCGGG - Intronic
1059417552 9:114171238-114171260 AATTGCGCTCAGAGAGGGCCAGG + Intronic
1060449646 9:123724689-123724711 ACCTGTGCTCAGAGAGGTTATGG - Intronic
1062608936 9:137364287-137364309 CTCTGTGCTCTGAAAGGGCCTGG - Intronic
1203744766 Un_GL000218v1:35652-35674 ATGTGGGCTCACTGAGGGTCAGG + Intergenic
1203565340 Un_KI270744v1:83832-83854 ATGTGGGCTCACTGAGGGTCAGG - Intergenic
1187407949 X:19021428-19021450 ATGTGTGGTCAGAGAGTCTCTGG - Intronic
1192762071 X:74104413-74104435 ATCTCTGCACAGAAAGGGTGGGG - Intergenic
1193026565 X:76851589-76851611 ATCTATGCTCAGGAAGGGTCTGG + Intergenic
1196052700 X:111322233-111322255 ATAGGGGCTCAGAGAGGGTATGG + Intronic
1196528134 X:116750926-116750948 ATCTGTGCTCAGGAAGGATGGGG + Intergenic
1197516895 X:127443460-127443482 ATCTGTGTTTAAAGGGGGTCTGG - Intergenic
1199855207 X:151753932-151753954 ACCTGTTCTGAGAGAGGGTAAGG + Intergenic
1200138851 X:153887339-153887361 ATCTGTGCTCAGAGAGGGTCTGG + Intronic