ID: 1200141125

View in Genome Browser
Species Human (GRCh38)
Location X:153903650-153903672
Sequence CACCCTAACAGGGCCGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 255}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200141112_1200141125 -5 Left 1200141112 X:153903632-153903654 CCCACCCTGTGTTCCCACCACCC 0: 1
1: 0
2: 9
3: 67
4: 531
Right 1200141125 X:153903650-153903672 CACCCTAACAGGGCCGGGAGGGG 0: 1
1: 0
2: 1
3: 20
4: 255
1200141113_1200141125 -6 Left 1200141113 X:153903633-153903655 CCACCCTGTGTTCCCACCACCCT 0: 1
1: 0
2: 10
3: 90
4: 573
Right 1200141125 X:153903650-153903672 CACCCTAACAGGGCCGGGAGGGG 0: 1
1: 0
2: 1
3: 20
4: 255
1200141115_1200141125 -10 Left 1200141115 X:153903637-153903659 CCTGTGTTCCCACCACCCTAACA 0: 1
1: 0
2: 1
3: 16
4: 242
Right 1200141125 X:153903650-153903672 CACCCTAACAGGGCCGGGAGGGG 0: 1
1: 0
2: 1
3: 20
4: 255
1200141114_1200141125 -9 Left 1200141114 X:153903636-153903658 CCCTGTGTTCCCACCACCCTAAC 0: 1
1: 0
2: 1
3: 23
4: 265
Right 1200141125 X:153903650-153903672 CACCCTAACAGGGCCGGGAGGGG 0: 1
1: 0
2: 1
3: 20
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200141125 Original CRISPR CACCCTAACAGGGCCGGGAG GGG Intronic
900427603 1:2587595-2587617 CACCCCCGCAGGGCAGGGAGGGG - Intronic
901417179 1:9125367-9125389 TAACCCAACAGGGCCAGGAGTGG - Intronic
902327874 1:15714228-15714250 AACCAAAACAGGGCCGGGTGTGG - Intronic
902896188 1:19481740-19481762 CACCCCAAAAGGCCTGGGAGTGG + Intronic
904674598 1:32191238-32191260 CCCCCTTACAGGGCTGGCAGAGG + Intronic
904847536 1:33431166-33431188 CACCCTAGAAGGGCGGGGATTGG + Intergenic
905562129 1:38935902-38935924 CACCCAAATAGGGCCGGGTGTGG - Intronic
906537972 1:46562509-46562531 CACCGTGACAGGAGCGGGAGAGG + Intronic
906894287 1:49754482-49754504 CAGGCAAACAGGGCCTGGAGTGG - Intronic
907435980 1:54448529-54448551 CAGGCAAACAGGGCCTGGAGCGG - Intergenic
911022907 1:93407218-93407240 CACGCAAACAGGGTCTGGAGTGG - Intergenic
911490049 1:98553167-98553189 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
913512557 1:119574712-119574734 CAGCCAAACAGGGTCTGGAGTGG + Intergenic
918612734 1:186511710-186511732 CAGGCAAACAGGGCCTGGAGTGG - Intergenic
919654762 1:200186230-200186252 CAGGCAAACAGGGTCGGGAGTGG + Intergenic
919974316 1:202600818-202600840 CACCTTACCAGGGCCTGGGGTGG - Intronic
920007145 1:202841718-202841740 CAACCAAAATGGGCCGGGAGCGG + Intergenic
922566040 1:226602395-226602417 CACCCAGACAGGGCCCGGTGTGG - Exonic
922676029 1:227550575-227550597 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
923258789 1:232246331-232246353 CACCCTAACAGGGTCTGAATGGG - Intergenic
923861879 1:237899673-237899695 GAACCTAACTGGGCCGGGTGTGG + Intergenic
924425254 1:243944450-243944472 AACCCTAACAGAGGAGGGAGTGG + Intergenic
1062775171 10:138405-138427 AACGCCAACAGGGCCGGGTGCGG - Intronic
1064825446 10:19393743-19393765 AACCCCATCAGGGCCGGGCGCGG - Intronic
1065736268 10:28755456-28755478 TACCCTACCAGGGCTGGCAGTGG + Intergenic
1066158547 10:32704271-32704293 CAGGCAAACAGGGCCTGGAGTGG - Intronic
1067321320 10:45223853-45223875 CAACTTCACAGGGCAGGGAGTGG + Intergenic
1068567701 10:58593590-58593612 CAGGCAAACAGGGTCGGGAGTGG + Intronic
1069925425 10:71847162-71847184 CAACCTGTCAGGGCCGGGTGCGG + Intronic
1072066790 10:91879315-91879337 CACCCTAACCAGGACTGGAGTGG - Intergenic
1074985069 10:118651564-118651586 CAGGCAAACAGGGCCTGGAGTGG - Intergenic
1076159119 10:128228868-128228890 CAGGCAAACAGGGCCTGGAGTGG - Intergenic
1076870619 10:133191407-133191429 TACCCCAACAGGGCCGGGTGTGG + Intronic
1077504623 11:2924326-2924348 CCCCCTCACAGGGCTGGGAGGGG - Intronic
1078336457 11:10466891-10466913 CAGCCAAACAGGGTCTGGAGTGG + Intronic
1078552508 11:12290253-12290275 CCCCCTAGCAGGGGTGGGAGTGG + Intronic
1080553983 11:33399241-33399263 AACACTAACTGGGCCGGGCGTGG - Intergenic
1081493977 11:43587904-43587926 CAACCCAACAGGGCCAGAAGTGG - Intronic
1084326083 11:68401011-68401033 CACAATAACAGGGCTGGGGGAGG - Intronic
1086548622 11:88028108-88028130 CACGCAAACAGGGTCTGGAGTGG + Intergenic
1086868997 11:92014810-92014832 CAGGCGAACAGGGCCTGGAGTGG - Intergenic
1089153808 11:116385386-116385408 AAGCCTAACTGGGCCGGGCGCGG + Intergenic
1091872559 12:3906601-3906623 TACCCAAACATGGCCGGGCGCGG - Intergenic
1092233362 12:6790591-6790613 CACCCTGCCAGGCCCAGGAGGGG - Intronic
1092332243 12:7595063-7595085 CAGGCAAACAGGGTCGGGAGTGG + Intergenic
1093501346 12:19815372-19815394 CAGGCAAACAGGGTCGGGAGTGG + Intergenic
1095920532 12:47525860-47525882 CAGGCTAACAGGGTCTGGAGTGG - Intergenic
1096602801 12:52742324-52742346 CACCCTCAGAGGCCCGGGAAGGG + Intergenic
1097774416 12:63628945-63628967 CACGCAAACAGGGTCTGGAGTGG + Intronic
1099965607 12:89441493-89441515 CAGGCAAACAGGGTCGGGAGTGG + Intronic
1100073828 12:90754776-90754798 CAGGCAAACAGGGTCGGGAGTGG - Intergenic
1100136378 12:91557632-91557654 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
1100253321 12:92855137-92855159 CATCCTATCACGGCCGGGCGCGG + Intronic
1101601157 12:106211746-106211768 CAGGCAAACAGGGCCAGGAGTGG - Intergenic
1102934926 12:116888491-116888513 AACCCTGACAGGGCCAGGTGCGG + Intergenic
1104859450 12:131916888-131916910 CACCCTAACTGGACCTCGAGAGG - Intronic
1110199624 13:72833539-72833561 CAGGCAAACAGGGTCGGGAGGGG - Intronic
1110652593 13:77959420-77959442 CAGGCAAACAGGGTCGGGAGTGG + Intergenic
1114736935 14:25051342-25051364 CACCCCAACAGGGCCAGGCTAGG - Intergenic
1116474592 14:45325499-45325521 CAGGCAAACAGGGTCGGGAGTGG - Intergenic
1116781877 14:49244978-49245000 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
1117930444 14:60836529-60836551 CAGGCAAACAGGGCCTGGAGTGG - Intronic
1119409775 14:74423255-74423277 CACCCTGACAGCTCTGGGAGTGG + Intronic
1122267001 14:100551226-100551248 CACCCTAGCAGGGCCGGGCCGGG - Intronic
1124918125 15:33996553-33996575 CAGGCAAACAGGGCCTGGAGTGG + Intronic
1126187279 15:45842428-45842450 CCCACTCACAGGGCAGGGAGGGG - Intergenic
1127031846 15:54872568-54872590 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
1129507858 15:76098371-76098393 CAGGCAAACAGGGTCGGGAGTGG - Intronic
1129975135 15:79815637-79815659 CTCCCTTTCAGGGCAGGGAGTGG - Intergenic
1131278508 15:91002332-91002354 TAACCAAACAGGGCTGGGAGCGG + Intronic
1135643772 16:24143519-24143541 CTCCCTAGCAGGGATGGGAGAGG + Intronic
1135885449 16:26301955-26301977 CGCACTCACAGGGCCGGGGGAGG - Intergenic
1138183878 16:54961891-54961913 CACCCCAAAAGAGCTGGGAGGGG + Intergenic
1138480020 16:57296449-57296471 CCCCTGAACAGGGCCGGGTGTGG - Intergenic
1140211631 16:72975149-72975171 AACCCTATCAGGGCCAGGTGTGG + Intronic
1140279528 16:73542088-73542110 CCACCAAACAGGGCCGGGCGCGG - Intergenic
1141981535 16:87553220-87553242 CAGGCTAACAGCGCAGGGAGAGG - Intergenic
1142124817 16:88405015-88405037 CAGTCTAACAGGGCGGGGAGGGG + Intergenic
1142740006 17:1926380-1926402 CTCCCAAACTGGGCCGGGCGCGG - Intergenic
1143785640 17:9253598-9253620 CACCCTAAGATGACAGGGAGGGG + Intronic
1147154229 17:38535495-38535517 AACCCAAACAGGGCCAGGCGCGG - Intronic
1147423006 17:40331893-40331915 CATCCTAGCATGGCCGGGGGTGG - Intronic
1147842097 17:43379028-43379050 CCCACTGACAGGGCAGGGAGAGG - Intergenic
1148559406 17:48597379-48597401 AACCCTACCAGGGCTGGGAGAGG + Intronic
1149365553 17:55939827-55939849 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
1149557590 17:57585109-57585131 GACCCTAAGAGGGCTGGGCGTGG - Intronic
1151663837 17:75534235-75534257 CATCCTCACAGGCCCAGGAGGGG + Intronic
1153226698 18:2905912-2905934 CTCCCTAAGCGGGCCGGGCGCGG - Intronic
1153535850 18:6100841-6100863 CACCCTAGCAGAGCTGGGAGGGG + Intronic
1153654917 18:7273716-7273738 CAGCCTAGCAGTGGCGGGAGAGG + Intergenic
1155017210 18:21855938-21855960 AATCATAACAGGGCCGGGCGCGG + Intronic
1155378206 18:25185672-25185694 CACCCTAACAGGCACGGTTGTGG + Intronic
1155476806 18:26243846-26243868 CAGCCAAACAGGGTCTGGAGTGG - Intronic
1158996906 18:62930897-62930919 CACACAAATAGGGCCGGGTGCGG + Intronic
1159014293 18:63088824-63088846 AACTGCAACAGGGCCGGGAGAGG + Intergenic
1159143544 18:64425135-64425157 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
1159931646 18:74318498-74318520 CAGCTTAAGAGGGCCGGGCGTGG + Intronic
1160610427 18:80080386-80080408 CACCAAAACAGGGCCCGGTGTGG - Intronic
1160908174 19:1461560-1461582 CAACCTCACTGGGCCGGGCGCGG + Intronic
1160958753 19:1707716-1707738 CAACATAAATGGGCCGGGAGTGG + Intergenic
1161843549 19:6696749-6696771 CACCCTAGCATTGCCGGGCGCGG + Intronic
1162316260 19:9939981-9940003 CAACCTAATAGGGCCAGGTGCGG + Intergenic
1162405636 19:10471582-10471604 CAGCCTAACAGGGCTGGGTGTGG - Intergenic
1162612327 19:11766525-11766547 CACCCCAACAAAGCCGGGCGTGG - Intergenic
1163974957 19:20841869-20841891 CAGCCAAACAGGGTCTGGAGTGG + Intronic
1166214776 19:41327825-41327847 CAGCCCCACAGGGCGGGGAGGGG - Intronic
1166446532 19:42862792-42862814 CACACAAACAGGGTCTGGAGTGG - Intronic
1166994282 19:46712248-46712270 CAAAATAACAGGGCCGGGAGCGG + Intronic
1167272045 19:48511363-48511385 CAGCCCAGCAGGGCCCGGAGCGG - Intronic
1167794020 19:51697488-51697510 CAGCCTCACAGGGCCGGTAGAGG - Intergenic
1167798564 19:51726397-51726419 CACCCGAGCAGGGCGGGGTGGGG - Intergenic
1168701527 19:58442462-58442484 AACTGTAACAGGGCCGGGCGCGG - Intergenic
925571892 2:5321313-5321335 TACACTAACAAGGCCAGGAGTGG + Intergenic
927301987 2:21526231-21526253 CAGGCAAACAGGGCCTGGAGTGG - Intergenic
927610693 2:24536744-24536766 CACACAAACAGGGTCTGGAGTGG - Intronic
928463439 2:31497173-31497195 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
930042557 2:47138973-47138995 TACCTTAACAGGGCTGGCAGCGG - Intronic
930517001 2:52420580-52420602 CAGGCAAACAGGGTCGGGAGTGG + Intergenic
930908837 2:56606108-56606130 CAGGCAAACAGGGTCGGGAGTGG - Intergenic
930911607 2:56636502-56636524 CAGGCAAACAGGGCCTGGAGTGG - Intergenic
931886615 2:66625271-66625293 CACACAAACAGGGTCTGGAGTGG - Intergenic
931907503 2:66858547-66858569 CACACAAACAGGGTCTGGAGTGG - Intergenic
931928276 2:67098885-67098907 CACGCAAACAGGGTCTGGAGTGG + Intergenic
932084572 2:68746714-68746736 CATCCCCACAGGGCCGGGCGCGG + Intronic
932267553 2:70381375-70381397 CTCCCTAGCAGGGCAGGAAGTGG - Intergenic
933063400 2:77767351-77767373 CACCTTCACAGGGCCGGGCAGGG + Intergenic
933893842 2:86792782-86792804 CACCATATCAGGGCCTGGATGGG + Intronic
934937773 2:98477753-98477775 GACCCACACAGGGCAGGGAGAGG - Intronic
935326364 2:101941305-101941327 CACCCTAGCAGTACCTGGAGAGG - Intergenic
936621357 2:114101561-114101583 CAGGCAAACAGGGCCTGGAGTGG - Intergenic
936769436 2:115894390-115894412 CAGGCAAACAGGGCCTGGAGTGG - Intergenic
937094066 2:119224336-119224358 CAGCCGAACAGGGCAGGGACAGG + Intronic
938864502 2:135403831-135403853 CAGGCAAACAGGGCCTGGAGTGG + Intronic
939072068 2:137555422-137555444 CAGGCAAACAGGGCCTGGAGTGG + Intronic
941565269 2:167098835-167098857 CAGCCAAACAGGGTCTGGAGTGG - Intronic
943130064 2:183842727-183842749 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
943359555 2:186901402-186901424 CACCAAAACAGGGTCTGGAGTGG - Intergenic
947494075 2:230620099-230620121 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
947589561 2:231377717-231377739 CCCCCAAACTGGGCCGGGCGCGG - Intergenic
948419589 2:237848718-237848740 CAGGCAAACAGGGCCTGGAGGGG - Intergenic
1169396953 20:5241033-5241055 CAGCCAAACAGGGTCTGGAGTGG - Intergenic
1172982215 20:38951932-38951954 CACTCAAACAGAGCCAGGAGAGG + Exonic
1176088397 20:63308318-63308340 CACCCAGACTGGGCCGGGTGTGG - Intronic
1177004664 21:15656611-15656633 AAACCAAATAGGGCCGGGAGTGG - Intergenic
1179449262 21:41457048-41457070 AACCCCAACAAGGCCGGGCGTGG - Intronic
1181042286 22:20197834-20197856 CACCCAGACAGGACGGGGAGAGG - Intergenic
1182120509 22:27783420-27783442 CACCATGACAGGGCCGGGCACGG - Intronic
1182180151 22:28339136-28339158 CAGGCAAACAGGGCCTGGAGTGG - Intronic
1182532244 22:30969372-30969394 CGCCCTACCAGACCCGGGAGGGG - Intergenic
1184074835 22:42169696-42169718 CACCCTCCCAGGGCCAGGAGGGG + Intronic
949428061 3:3941158-3941180 CAGGCAAACAGGGTCGGGAGTGG - Intronic
949532164 3:4966601-4966623 CAGGCAAACAGGGTCGGGAGTGG + Intergenic
950097873 3:10340457-10340479 CACCCTAACCAGGCCCGGGGTGG - Intronic
950746640 3:15095623-15095645 CAGCCTAACAGGGTTTGGAGAGG - Intronic
953720958 3:45354846-45354868 CTCCCTAACATGGCTGGGGGAGG - Intergenic
954828021 3:53391978-53392000 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
954978594 3:54722684-54722706 CAGGCAAACAGGGTCGGGAGTGG - Intronic
955606578 3:60711154-60711176 CACACAAACAGGGTCTGGAGTGG + Intronic
957061829 3:75488725-75488747 CAGGCTAACAGGGTCTGGAGTGG - Intergenic
957256522 3:77844672-77844694 CAGGCAAACAGGGCCTGGAGTGG - Intergenic
957596519 3:82273692-82273714 CAGGCAAACAGGGCCTGGAGTGG - Intergenic
958254356 3:91308159-91308181 TACCCTAACATGGCAGAGAGAGG + Intergenic
959092972 3:101924337-101924359 TACCCAAACAGGGTCTGGAGTGG - Intergenic
960065469 3:113367430-113367452 CAGGCAAACAGGGCCTGGAGTGG + Intronic
961041686 3:123682693-123682715 CTCTCCAACAGGGGCGGGAGGGG + Intronic
961291580 3:125850674-125850696 CAGGCTAACAGGGTCTGGAGTGG + Intergenic
961370215 3:126424173-126424195 CAGCATAACGGGGACGGGAGTGG + Intronic
962666775 3:137661446-137661468 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
963340104 3:144023245-144023267 CAGGCAAACAGGGCCTGGAGTGG - Intronic
965025592 3:163297615-163297637 CACGCAAACAGGGTCTGGAGTGG + Intergenic
968170254 3:196504034-196504056 CAGCCAAACAAGGCCGGGTGCGG + Intergenic
968500442 4:947484-947506 ACCAGTAACAGGGCCGGGAGTGG + Intronic
968717308 4:2169974-2169996 CACCCTCACAGGGCGGAGACTGG + Intronic
968860570 4:3166204-3166226 CAGGCAAACAGGGCCTGGAGTGG - Intronic
969445329 4:7241573-7241595 CACCCCAGAAGGGCAGGGAGGGG - Intronic
969870056 4:10098951-10098973 CACAGCAACAGGGCAGGGAGGGG + Intronic
970095889 4:12462166-12462188 CACGCTAACAGGGTCTGGAGTGG + Intergenic
970496357 4:16629480-16629502 CACGCAAACAGGGCCTGGAGTGG + Intronic
970655310 4:18224604-18224626 CAGGCAAACAGGGCCTGGAGTGG - Intergenic
971186544 4:24383076-24383098 CACGCAAACAGGGTCTGGAGTGG + Intergenic
972185256 4:36520466-36520488 GCCCCTAACAGGGCTGGGCGCGG - Intergenic
972675748 4:41257723-41257745 CGCCCTACCTGGGCCGTGAGGGG - Exonic
972786238 4:42329113-42329135 CACCCTATAAGGGCTGGGTGTGG - Intergenic
974090163 4:57302650-57302672 CAGGCAAACAGGGCCTGGAGTGG - Intergenic
975435058 4:74342663-74342685 CATCCTGCCAGGGCCAGGAGGGG - Intergenic
976669600 4:87637020-87637042 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
977110230 4:92943841-92943863 CAGGCAAACAGGGCCTGGAGTGG - Intronic
977829793 4:101576922-101576944 CAGGCAAACAGGGCCTGGAGTGG + Intronic
981885435 4:149667278-149667300 CAGGCAAACAGGGCCAGGAGTGG + Intergenic
981958127 4:150503432-150503454 CACGCAAACAGGGTCTGGAGTGG + Intronic
982323984 4:154109631-154109653 CAGGCAAACAGGGCCGGAAGTGG + Intergenic
982462458 4:155687931-155687953 CACCATTACAGGGCCGGGTGCGG + Intronic
987065105 5:14281984-14282006 CTCCCTAACAGGGCTGGCTGTGG + Intronic
987099982 5:14582503-14582525 CACCCAGACGGGGCCGGGCGCGG + Intronic
989072264 5:37523359-37523381 CAGGCAAACAGGGCCTGGAGTGG + Intronic
990084056 5:51952609-51952631 CAGGCAAACAGGGTCGGGAGTGG + Intergenic
992024600 5:72657988-72658010 CACCCTAACAGAGCTGACAGAGG - Intergenic
994565700 5:101442912-101442934 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
994622384 5:102178870-102178892 CAGGCAAACAGGGTCGGGAGTGG - Intergenic
995111941 5:108438048-108438070 CAGGCAAACAGGGTCGGGAGTGG + Intergenic
995529018 5:113074258-113074280 CACACAAACAGGGTCTGGAGTGG + Intronic
996749568 5:126875200-126875222 CACCCTAAGAGCTCAGGGAGAGG - Intronic
996773312 5:127108362-127108384 CAGGCAAACAGGGCCTGGAGTGG - Intergenic
996956176 5:129186349-129186371 CACACAAACAGGGTCTGGAGTGG - Intergenic
998309230 5:141110535-141110557 CAAACAAACAGGGCCGGGCGCGG + Intronic
1000082529 5:157861436-157861458 CACCCAAACAGGCCCAGGGGAGG - Intergenic
1000577643 5:162994496-162994518 GACACTAACAGGGCCGGGCGTGG + Intergenic
1002677262 5:180927172-180927194 CAAGCAAACAGGGCCTGGAGTGG + Intronic
1002872455 6:1179171-1179193 CCCCCAAAAAGGGCTGGGAGTGG + Intergenic
1004500174 6:16202150-16202172 AACCCTAAGGGGGCCGGGCGAGG + Intergenic
1004831619 6:19482603-19482625 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
1006866292 6:37211530-37211552 CACACAAACAGGGCCGGGTTCGG - Intergenic
1007829041 6:44624418-44624440 CAGCCTAGCTGGGCCAGGAGTGG + Intergenic
1009189471 6:60612327-60612349 TACCCTAACATGGCAGAGAGAGG - Intergenic
1009782147 6:68284744-68284766 CAGCCAAACAGGGTCTGGAGTGG + Intergenic
1009959405 6:70500772-70500794 CAGGCAAACAGGGCCTGGAGTGG - Intronic
1010553584 6:77252385-77252407 CAGGCAAACAGGGTCGGGAGTGG + Intergenic
1011513178 6:88124214-88124236 CACCCTAACAGAACCTGGAATGG + Intergenic
1011953412 6:92996037-92996059 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
1012459810 6:99447924-99447946 CAGGCAAACAGGGCCTGGAGTGG + Intronic
1012518584 6:100093022-100093044 AAACCTTACAGGGCCGGGCGTGG + Intergenic
1012590057 6:100969546-100969568 CAAGCAAACAGGGCCTGGAGTGG + Intergenic
1015191461 6:130476384-130476406 CAGGCAAACAGGGTCGGGAGTGG + Intergenic
1016046617 6:139487325-139487347 TACCCTAAAATGGCCGGGCGTGG - Intergenic
1020358174 7:7300600-7300622 CAGGCAAACAGGGTCGGGAGTGG - Intergenic
1020487568 7:8738413-8738435 CAGCCAAACAGGGTCTGGAGTGG - Intronic
1020981290 7:15072415-15072437 TACCCAAAAAGGGCCGGGCGCGG + Intergenic
1022884533 7:34628957-34628979 CAGGCAAACAGGGTCGGGAGTGG + Intergenic
1023886097 7:44357654-44357676 CACCACAACAGGGCCAGGTGTGG - Intergenic
1024372820 7:48606508-48606530 CACCCAAACAGGGTCTGGAGCGG - Intronic
1024460112 7:49650602-49650624 CACGCAAACAGGGTCTGGAGTGG + Intergenic
1025582846 7:62742037-62742059 CAGGCTAACAGGGTCTGGAGTGG - Intergenic
1025869296 7:65415651-65415673 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
1029390059 7:100269123-100269145 AACTGTAACCGGGCCGGGAGTGG + Intronic
1029722535 7:102378500-102378522 GAACCTAACATGGCCGGGCGTGG + Intronic
1029829912 7:103245460-103245482 CACGCAAACAGGGTCTGGAGTGG + Intergenic
1029916076 7:104210601-104210623 CACGCAAACAGGGTCTGGAGTGG + Intergenic
1030202548 7:106919642-106919664 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
1030830912 7:114220150-114220172 AACCCTCACAGGGCCAGGAACGG - Intronic
1034314588 7:150117933-150117955 CAGGCAAACAGGGCCTGGAGTGG + Intergenic
1034706488 7:153150103-153150125 TACTGTAACAGGGCCGGGCGCGG - Intergenic
1035296956 7:157872769-157872791 AGCCCTGACAGGGCGGGGAGGGG - Intronic
1035381549 7:158444233-158444255 CCTCCTAACAGGTCCTGGAGAGG + Intronic
1035444518 7:158930956-158930978 CAGACTAACAAGGCCGGGCGTGG - Intronic
1037706701 8:21321495-21321517 CAGCCTAACAGGGCCCAGTGGGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1037992359 8:23330033-23330055 AACCCAAACAGGGCCAGGTGCGG + Intronic
1038795540 8:30706207-30706229 TAACCTAAGAGGGCCAGGAGTGG + Intronic
1039856754 8:41421815-41421837 AACCTTAAAAGGGCCGGGCGCGG + Intergenic
1040024577 8:42770088-42770110 CCCCCTGACATGGCCGGGTGCGG - Intronic
1040608470 8:48959147-48959169 CAGGCAAACAGGGCCTGGAGTGG - Intergenic
1040779998 8:51095819-51095841 CAGCCAAACAGGGTCTGGAGAGG + Intergenic
1041295789 8:56356462-56356484 CAGGCAAACAGGGTCGGGAGTGG - Intergenic
1041323217 8:56636626-56636648 CAGCCTAATAGGGTCTGGAGTGG - Intergenic
1042547856 8:69966645-69966667 CTCCGTCTCAGGGCCGGGAGCGG + Intergenic
1044909731 8:97044746-97044768 CAGGCAAACAGGGTCGGGAGTGG - Intronic
1049964708 9:767588-767610 CACGCAAACAGGGCCTGGAGTGG + Intergenic
1050234287 9:3562180-3562202 CAGGCAAACAGGGCCGGGAGTGG - Intergenic
1051987328 9:23105959-23105981 CAGGCTAACAGGGTCTGGAGTGG + Intergenic
1052257031 9:26469288-26469310 CATCCTCACATGGCAGGGAGAGG + Intergenic
1052478386 9:28990736-28990758 CAGGCTAACAGGGTCTGGAGTGG + Intergenic
1057190207 9:93083097-93083119 CACCCTGACAGGGCCGTGAGAGG + Intronic
1059433113 9:114261486-114261508 CAGCCCCACAGGGCAGGGAGAGG - Intronic
1060040444 9:120295825-120295847 CAGCCTGACAGGGCTGGGTGTGG - Intergenic
1061377642 9:130235646-130235668 CACCCCGCCAGGGCCGGGAAGGG - Exonic
1061550381 9:131331196-131331218 CACCCCAGCAGTGCAGGGAGGGG + Intergenic
1186563639 X:10638884-10638906 CAGGCAAACAGGGCCTGGAGTGG + Intronic
1189334393 X:40161801-40161823 GACCCTAACAGGGCTAGGCGCGG - Intronic
1191824248 X:65347152-65347174 CACGCAAACAGGGTCTGGAGTGG + Intergenic
1197022129 X:121704553-121704575 CACACTAACAAGACTGGGAGAGG - Intergenic
1197822968 X:130560262-130560284 CACCTTCACAGGGCTGGGCGTGG - Intergenic
1198449511 X:136753001-136753023 CACGTTCACAGGGCCAGGAGCGG - Intronic
1198863114 X:141091886-141091908 TACCCTATGAGGGCCGGGAGGGG + Intergenic
1198899576 X:141495501-141495523 TACCCTATGAGGGCCGGGAGGGG - Intergenic
1200141125 X:153903650-153903672 CACCCTAACAGGGCCGGGAGGGG + Intronic
1200760634 Y:7035780-7035802 CACCCCAACAGGCCCTGGTGTGG - Intronic
1201511639 Y:14770401-14770423 CACGCAAACAGGGACTGGAGTGG + Intronic