ID: 1200143371

View in Genome Browser
Species Human (GRCh38)
Location X:153913139-153913161
Sequence CAGGCGGGAGGGGAGGACCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 704
Summary {0: 1, 1: 0, 2: 3, 3: 68, 4: 632}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200143357_1200143371 29 Left 1200143357 X:153913087-153913109 CCAGGGGTCTTCAAGGCATCCCA 0: 1
1: 0
2: 1
3: 15
4: 160
Right 1200143371 X:153913139-153913161 CAGGCGGGAGGGGAGGACCGTGG 0: 1
1: 0
2: 3
3: 68
4: 632
1200143361_1200143371 9 Left 1200143361 X:153913107-153913129 CCAGAGAGAAAGGTGTGGATAAG 0: 1
1: 0
2: 2
3: 31
4: 434
Right 1200143371 X:153913139-153913161 CAGGCGGGAGGGGAGGACCGTGG 0: 1
1: 0
2: 3
3: 68
4: 632
1200143360_1200143371 10 Left 1200143360 X:153913106-153913128 CCCAGAGAGAAAGGTGTGGATAA 0: 1
1: 0
2: 3
3: 16
4: 255
Right 1200143371 X:153913139-153913161 CAGGCGGGAGGGGAGGACCGTGG 0: 1
1: 0
2: 3
3: 68
4: 632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200143371 Original CRISPR CAGGCGGGAGGGGAGGACCG TGG Intronic
900088652 1:909926-909948 CAGGCCGGGAGGAAGGACCGAGG + Intergenic
900150457 1:1176713-1176735 CAGGCGAGAGGGGAGGCCCGGGG - Intronic
900199660 1:1398834-1398856 CTGGCGGGCGGGGAGGCCCCGGG + Intronic
900351831 1:2238625-2238647 CAGGCGGGAGAGGAGCACACTGG + Intronic
900457902 1:2786251-2786273 GAGGCAGTAGGGGAGGATCGGGG - Intronic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
900830141 1:4959933-4959955 GAGAGGGGAGGGGAGGACAGAGG + Intergenic
900998472 1:6135426-6135448 CAGCCAGGAGCAGAGGACCGGGG + Intronic
901428603 1:9198938-9198960 CAGGCGGGCGGGGAGGGCGGGGG + Intergenic
901608146 1:10475233-10475255 CAGGCGGGAAGTGGGGACCCGGG - Intronic
901630032 1:10643506-10643528 CAGGCTGGAGAGGAGGCCCAGGG - Intronic
901884026 1:12210179-12210201 CAGGCTGGAGGACAGGACCATGG - Intergenic
901907450 1:12426240-12426262 CAGGCGGGAGGAAAGGCCTGGGG - Intronic
902039731 1:13483926-13483948 GAGTGGGGAGGGGAGGAGCGGGG + Intronic
902117849 1:14136657-14136679 CAGGAGGGAGGGGAAGGCCAGGG + Intergenic
902243113 1:15101765-15101787 CAGCAGGGAGGTGAGGACCAGGG + Exonic
902250886 1:15153713-15153735 CGTGCGGGAGGGAGGGACCGCGG - Intronic
902519854 1:17010088-17010110 CAGGGGGGAAGGGGGGAACGGGG - Intronic
903555075 1:24187279-24187301 GAGGCGGGAGGCGGGGACCTGGG - Intronic
903557380 1:24203475-24203497 CAGGAGGGAGGGAAGGAGGGAGG - Intergenic
903666289 1:25009517-25009539 CAGTGGGGAGAGGAGGACCCAGG - Intergenic
903945971 1:26962910-26962932 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
904336302 1:29800501-29800523 CAGCCTGGAGGAGAGGAACGGGG - Intergenic
904562872 1:31410492-31410514 CAGGCAGGAGGCCAGGACAGTGG + Intronic
904598583 1:31661766-31661788 CTGGAGAGAGGGGAGGACAGAGG - Intronic
904626683 1:31810071-31810093 CAGAGGGGAGGGGAGGGCAGAGG - Intronic
905060631 1:35136469-35136491 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
905179470 1:36157031-36157053 AAGGAGGGAGGGGAGGAGAGAGG + Intronic
905893728 1:41532248-41532270 CAGGAGAGAAGGGAGGACAGGGG + Intronic
906080811 1:43087058-43087080 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
906379806 1:45325621-45325643 CAGGCAGGAGGGCAGTACCCAGG - Intergenic
906510148 1:46406069-46406091 CAGGAGGCAGGTGAGGTCCGTGG + Exonic
907243002 1:53090933-53090955 CCGGCAGGAGGTAAGGACCGCGG + Intronic
907292521 1:53425838-53425860 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
907437427 1:54458757-54458779 CAGGAGGGAGGGAAGGAAGGAGG + Intergenic
907521146 1:55024168-55024190 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
907905959 1:58783992-58784014 GAGGCGGGAGTGGAGGTGCGCGG - Exonic
908534579 1:65066523-65066545 CCGGCCGGAGGGGAGGAGGGTGG - Intergenic
909729274 1:78873458-78873480 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
910192148 1:84605413-84605435 CAGGGTGGAGGGGATGACAGTGG - Intergenic
912174795 1:107141571-107141593 CAGGCGGGAGGGAAGGCTCCGGG + Intronic
913107720 1:115629780-115629802 GAGGCAGGATGGGAGCACCGTGG - Intergenic
913326429 1:117632300-117632322 CAGGCTGGAGAGGAGGGCGGGGG + Intergenic
914313474 1:146487396-146487418 GAGGCGGGAGGGCGGGAGCGGGG + Intergenic
914500874 1:148245985-148246007 GAGGCGGGAGGGCGGGAGCGGGG - Intergenic
914876043 1:151513244-151513266 CAAGGGGAAGGGGAGGGCCGGGG - Intronic
915288566 1:154868119-154868141 GAGGTGGGAGGGGAGAACTGGGG + Intronic
915953429 1:160205254-160205276 CAGGAGGGGGCGGGGGACCGAGG - Intergenic
916742383 1:167657602-167657624 CAGAGGGGAGGGGAGGAAGGAGG - Intronic
917790564 1:178496386-178496408 CAGGTGGGAGGGGAGGGCGCAGG - Intergenic
918376694 1:183916525-183916547 CAGGACGGAGGGGAGGAGAGGGG - Exonic
919746900 1:201014415-201014437 AGGGCGGAAGGGGAGGACAGAGG + Intronic
919788984 1:201277847-201277869 CTGGCAGGAGGTGAGGACAGCGG + Intergenic
919805673 1:201379862-201379884 CAGGCGGGTGGGGAGGCCTCTGG - Intronic
920340632 1:205273074-205273096 CAGCCGGGATGGGAGGCACGTGG + Exonic
920728375 1:208459275-208459297 CAGGAGGTAGGAGAGGACTGGGG - Intergenic
920914807 1:210251388-210251410 CATGGGGGAGGGGAGGACGGGGG + Intergenic
922116482 1:222618381-222618403 CAGGCGGGATGGGCTGAACGCGG + Intronic
922740951 1:228013983-228014005 CAGGCAGGTGTGGAGGACCAGGG - Intronic
922845569 1:228681478-228681500 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
923429340 1:233905368-233905390 GCGGCGGGAAGGGAGGAGCGCGG + Intronic
924289633 1:242524463-242524485 CGGGCGGGAGGGGGCGATCGCGG + Exonic
924517688 1:244780120-244780142 CAGGAGGGAGGGGAGGACGTGGG - Intergenic
924623187 1:245679967-245679989 CAGGCGGGAGGGATGGAGGGAGG - Intronic
924711114 1:246530781-246530803 CAGGATGGAGGGGAAGACAGTGG - Intergenic
924772135 1:247087884-247087906 CAGCCAGGAGGGGAGGACCCAGG + Intergenic
1062817701 10:512872-512894 CAGGCTGGAGTGGAGTACAGTGG - Intronic
1062895579 10:1100900-1100922 CAGTCGGGACGGGGGGCCCGAGG - Intronic
1062914243 10:1235256-1235278 CAGGTGGGAGTGGAGAACCGTGG + Intronic
1062914412 10:1236015-1236037 CAGGTGGGAGTGGAGAACCGTGG + Intronic
1063030695 10:2231915-2231937 CAGGTAGGATGGGGGGACCGTGG + Intergenic
1063030711 10:2231971-2231993 CAGGTAGGATGGGGGGACCGTGG + Intergenic
1063030741 10:2232083-2232105 CAGGTAGGATGGGGGGACCGTGG + Intergenic
1063030787 10:2232251-2232273 CAGGTAGGATGGGGGGACCGTGG + Intergenic
1063030817 10:2232363-2232385 CAGGTAGGATGGGGGGACCGTGG + Intergenic
1063944819 10:11165883-11165905 GAGGCGGGAGAGAGGGACCGAGG + Intronic
1065044950 10:21738817-21738839 CAGGCTGAAGAGGAGGACCCAGG - Intronic
1065443301 10:25773350-25773372 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1065797237 10:29318859-29318881 CAGGGGGGTGGGAAGGACAGAGG + Intergenic
1065840999 10:29700984-29701006 CAGGCGGCAGGGCTGGAGCGTGG - Intronic
1065945919 10:30605474-30605496 CAGGGGGGTGGGAAGGACAGAGG - Intergenic
1066198955 10:33127943-33127965 CGGGGGGGAGGGGAGGGGCGGGG - Intergenic
1066261445 10:33733151-33733173 AAGGAGGGAGGGGAGGAGGGAGG + Intergenic
1069738453 10:70672645-70672667 CAGGCGGGAGGGAAGCAGCTAGG + Intergenic
1069840585 10:71337083-71337105 CAGGCTGAAGGGGAGGCCAGAGG - Intronic
1069881573 10:71596887-71596909 CAGCGGGGAGGTGGGGACCGGGG - Intronic
1070537709 10:77392096-77392118 AAGGAGGGAGGGAAGGACGGAGG + Intronic
1070806289 10:79272958-79272980 CAGGCTGGAGAGGATGACAGGGG + Intronic
1071519453 10:86320010-86320032 CAGGCACGAGGGGAGGCCCCAGG - Intronic
1072613587 10:97035150-97035172 CAGTCGGGAGCGGAGGAAAGCGG - Intronic
1072615450 10:97046524-97046546 CAGGAGGGTGGGGAGAACTGAGG - Intronic
1072679658 10:97498181-97498203 CGGGCGGGAAGGGAGGAGCGGGG - Intronic
1073053433 10:100684034-100684056 CAGGGGGGAGGGGAGGAGCAGGG + Intergenic
1073062558 10:100741271-100741293 CAGGAGGGAGGGAGGGAGCGAGG + Intronic
1073208606 10:101781430-101781452 CAGGTGGGAAGGGAGGCCCCGGG + Exonic
1073625343 10:105091074-105091096 CAGGAGGGAGGGAAGGAAGGAGG - Intronic
1074039023 10:109769789-109769811 CTGGCTGGAGGGGAGGTCAGGGG + Intergenic
1074405530 10:113177526-113177548 CAGGCTGGAGAGGAGGAACCTGG - Intergenic
1074776467 10:116771325-116771347 CAGAGGGGAGGGGAGGACAGGGG + Intergenic
1076067861 10:127463530-127463552 CAGGCAGGCTGGGAGGACCCTGG - Intergenic
1076202521 10:128569695-128569717 CAGGCTGTCGGGGAGGAGCGGGG + Intergenic
1076406875 10:130218406-130218428 CAGGCCGGGAGGGAGGACCCAGG + Intergenic
1076501070 10:130936472-130936494 GAGGAGGGAAGGGAGGACCATGG - Intergenic
1077332889 11:1991052-1991074 CAGGCGGGAGGCCGGGTCCGCGG - Intergenic
1077505784 11:2929492-2929514 CAGGCGGGCGGGGTGGCCCGAGG - Intergenic
1077898802 11:6473939-6473961 CAGGCCGGAGGGAGGGGCCGGGG + Intronic
1078316020 11:10293969-10293991 CCGGGGGGCGGGGAGGCCCGGGG + Intronic
1078369857 11:10735685-10735707 GAGGCGGGAGGAGAGGACAGAGG - Intergenic
1078891137 11:15560100-15560122 GAAGCGGGAGGGGAGGGCAGAGG + Intergenic
1080641518 11:34161196-34161218 CAGGCGGGAGGGGGCGGGCGGGG - Intronic
1080916629 11:36666774-36666796 CAGGATGGAGGGGAAGACAGTGG - Intergenic
1082767388 11:57180427-57180449 CGAGGGTGAGGGGAGGACCGAGG + Intergenic
1082791068 11:57347183-57347205 CAGAGGTGAGGGGAGGACAGAGG + Exonic
1083034963 11:59628526-59628548 CAGGCGGGTGGGCAGGAGGGAGG - Intergenic
1083171170 11:60924735-60924757 TCAGCGGGAGGGGAGGGCCGGGG + Intronic
1083442815 11:62688161-62688183 CAGCCAGTAGTGGAGGACCGGGG + Exonic
1083605941 11:63978960-63978982 CAGGTGAGAGGGGAGGGCTGTGG + Intronic
1083770465 11:64864205-64864227 CAGGCTGGAGGCCAGGACCCCGG - Intronic
1083824135 11:65188703-65188725 CTGGCGGCGGGGGAGCACCGCGG + Exonic
1083897293 11:65626277-65626299 CAGGAAGGAGGGCAGGACCAGGG - Intronic
1083903640 11:65656006-65656028 CAGGAGGAAGGGGAGGAGCCAGG + Intronic
1083986078 11:66216395-66216417 CAGGGTGGAGGGGAGGGCCAGGG - Intronic
1084004336 11:66315165-66315187 CAGGAGGGTGGGGAGGGCTGCGG + Exonic
1084090760 11:66878253-66878275 CAGGTGGGAGGAAAGGACTGGGG - Intronic
1084353943 11:68624427-68624449 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1084416074 11:69033673-69033695 GAGGTGGGAGGGGAGGCCCCGGG - Intergenic
1084546931 11:69819280-69819302 CCGGCGGGTGGGGAGCCCCGCGG + Intergenic
1084689650 11:70717594-70717616 CTGCGGGGACGGGAGGACCGTGG - Intronic
1084720935 11:70905163-70905185 CAGGCAGGTGAGGAGGACCTGGG + Intronic
1084947118 11:72644100-72644122 CAGGCAGGAGGGAAGGATCTGGG - Intronic
1085051087 11:73380613-73380635 CAGGCAGGAGGTGAGGGTCGAGG + Intronic
1085409616 11:76283400-76283422 CAGGTGGGAGGGGAGGAGAAGGG + Intergenic
1085475937 11:76788942-76788964 CAGGAGGGAGGGGTGGCCCGAGG + Intronic
1085527455 11:77172653-77172675 GAAGCGGGAGGGGAGGTCAGCGG - Intronic
1085934156 11:81123383-81123405 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1086439589 11:86814831-86814853 CAGGCAGGAGGGGATGGCAGAGG - Intronic
1088505378 11:110522209-110522231 CAGGGGGCAGGTGAGGACCTGGG - Intergenic
1089186146 11:116615896-116615918 CAGGGGGAAGGGGATGACAGTGG + Intergenic
1089728992 11:120508823-120508845 CAGGCTGGAGTGGAGTACAGTGG - Intergenic
1089768634 11:120786522-120786544 CAGGTGGGTGGGCAGGACTGGGG - Intronic
1089796662 11:120986294-120986316 GGGGCGGGAGGGGAGGGGCGGGG + Exonic
1089848731 11:121479218-121479240 GAGGCGGGAGGGCAGGAACCGGG + Intronic
1090044016 11:123315332-123315354 AAGGAGGGAGGGGAGGAGGGAGG - Intergenic
1091183557 11:133628353-133628375 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1091188091 11:133664570-133664592 CAGGAGGGAGGGGAGAAGCTTGG + Intergenic
1091261782 11:134240265-134240287 CATGCGGTGGGGGAAGACCGTGG + Intronic
1202815872 11_KI270721v1_random:46228-46250 CAGGCGGGAGGCCGGGTCCGCGG - Intergenic
1091793446 12:3284333-3284355 AAGGCTGGCGGGGAGGACCGTGG - Exonic
1092770425 12:11891684-11891706 CAGGCAGGGCGGGAGGACAGAGG - Exonic
1092817286 12:12323018-12323040 GAGGGGGGAGGGGAGGAGAGGGG + Intergenic
1093017632 12:14170926-14170948 CAGAGGGGAGGGGAGGAGAGAGG + Intergenic
1094316168 12:29139180-29139202 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1095310691 12:40693239-40693261 CAGGTGGGAGGGAGAGACCGCGG + Intronic
1095985616 12:47997626-47997648 CAGGGGGGCCGGGAGGACCAGGG + Exonic
1096114481 12:49047455-49047477 CAGGCTGGAGTGGAGTACAGTGG + Intronic
1096146520 12:49282587-49282609 CTGGCTGGAGGGGAGGGCAGTGG - Intergenic
1096413194 12:51391663-51391685 CGGCCGGGAGGGTGGGACCGGGG + Intronic
1097042816 12:56165841-56165863 AAGTCGGGTGGGGAGGACAGAGG - Intronic
1097170667 12:57110914-57110936 CATGGGGGAGGGGAGTACTGAGG + Intronic
1097180998 12:57171901-57171923 CAGGCTGGAGGGCAGGGCCAGGG - Intronic
1097281734 12:57848827-57848849 CAGGCAGGAGCTGAGGACTGAGG + Intergenic
1097519423 12:60648403-60648425 CAGGGTGGAGGGGAAGACAGTGG + Intergenic
1097872074 12:64610343-64610365 CGGGCGGGCGGGGAGGGTCGCGG + Intergenic
1098369310 12:69739423-69739445 CGGCCGGGAGCGGAGGGCCGCGG + Exonic
1098387679 12:69935972-69935994 CAGGGGGGAGGGGATGGCCACGG - Intronic
1099872632 12:88368872-88368894 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1100322588 12:93509857-93509879 CATGGGGGAGGGGAGCACTGAGG - Exonic
1101626794 12:106451629-106451651 AAGGCGGGGGGGGAGGAGAGGGG + Intronic
1101879711 12:108617847-108617869 CAGGCAGGAGGGGAGGGCACAGG + Intergenic
1101948376 12:109155125-109155147 TTGGCGGGAGGGGAGGAAGGAGG + Intronic
1102226243 12:111230197-111230219 AGGGGGGGAGGGGAGGAACGGGG + Intronic
1102482478 12:113233276-113233298 CAGGCGAGTGGGGAGGAGAGTGG - Intronic
1102512048 12:113422423-113422445 CAGGCTGGAGGGCAGGAGCTGGG + Exonic
1102554912 12:113720561-113720583 GAGGCTGCAGGGGAGGACTGGGG - Intergenic
1103080018 12:118016574-118016596 CAGGCTGGAGGGGCGGAGCTTGG + Intronic
1103363976 12:120369230-120369252 CGGGCGGGCGGGGACGGCCGAGG + Intergenic
1103704952 12:122866418-122866440 CAGGCGGGAGAGGAGGAGCTGGG + Exonic
1103893764 12:124259738-124259760 CAGGCGGCCGGGGAGGGGCGGGG - Intronic
1103962336 12:124617029-124617051 GAGGCGGGAGGGGAGGGCGGAGG - Intergenic
1104083826 12:125456995-125457017 CAGCAGGGAGGGGAGGACCTCGG - Intronic
1104442138 12:128802389-128802411 CAGGTGGGAGCTGAGGACCTTGG - Intronic
1104647724 12:130509049-130509071 CAGGCTGGTGGGGAGGGCCGGGG - Intronic
1105002935 12:132702834-132702856 CAGGAGGGAGGAAAGGACCAGGG + Intronic
1105429441 13:20323989-20324011 AAGGAGGGAGGGAAGGACGGAGG - Intergenic
1105546494 13:21354668-21354690 CAAGCAGGAGGGGAGGTCCCAGG - Intergenic
1106631812 13:31481932-31481954 GAGGGGGGAGGGGAGGACAGGGG + Intergenic
1107145858 13:37059717-37059739 CGGGCGGAAGGGGAGGAGCCGGG + Intergenic
1107660480 13:42634149-42634171 CAGGTGGGGAGGGAGGACAGAGG - Intergenic
1110845233 13:80185226-80185248 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1112490493 13:99858988-99859010 CAGGCTGGAAGGAAGGACCCGGG - Exonic
1113378963 13:109786188-109786210 CAGGCGGTGGGGAAGGTCCGGGG + Exonic
1113926889 13:113946730-113946752 CAGGGTGGAGGGGAGGACCCAGG - Intergenic
1114492568 14:23112661-23112683 AAGGGGTGAGGGGAGGACCAAGG + Intergenic
1114533052 14:23407324-23407346 CAGGGTGGAGGAGAGGAGCGGGG - Intronic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115389797 14:32841987-32842009 CAGGAGGGAGGGGAGGGGAGGGG - Intergenic
1115651451 14:35405011-35405033 CAGGCTGCAGGGAAGTACCGGGG - Intergenic
1116703399 14:48266515-48266537 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1117098796 14:52324255-52324277 CAGGAGGGTGGGGAGGACCTGGG + Intronic
1117513164 14:56473004-56473026 CAGGCTGGATGGAAGGACTGTGG + Intergenic
1118269875 14:64332914-64332936 CAGGCTGGAGGGTAGGGCAGTGG + Intronic
1118796682 14:69151687-69151709 CAGGGAGGAGGGGACGACGGCGG + Intronic
1118934139 14:70270868-70270890 CAGGCTGGAGTGGAGTACAGTGG + Intergenic
1118937408 14:70300335-70300357 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1119227724 14:72956748-72956770 CAGGCAGGTGGGGAGGTCCTGGG + Intronic
1119385994 14:74258479-74258501 GAGTCGGGAGGGGAGGACCGAGG - Intronic
1119617089 14:76106000-76106022 CAGGAAGAAGGGGAGGTCCGTGG - Intergenic
1119743603 14:77028880-77028902 GAGGGGGGAGGGGAGGGCGGAGG - Intergenic
1119924848 14:78483733-78483755 CAGGTGAGAGGGGAGGACTCTGG + Intronic
1121421520 14:93818985-93819007 CATGCTGGAGGGGAGGTCCATGG - Intergenic
1121433018 14:93900579-93900601 CAGGCAGGAGGGGAGGCAGGTGG + Intergenic
1121642890 14:95497981-95498003 CAGGCTGGAGGGGAGTGCAGTGG - Intergenic
1122130979 14:99604404-99604426 CGGCCGGGAGGGCGGGACCGCGG - Intergenic
1122140582 14:99660674-99660696 CAGGAGGGAGAGGAAGACCACGG - Intronic
1122231126 14:100306697-100306719 CCGGCGGGAGGGGACGCGCGGGG + Intergenic
1122722143 14:103728147-103728169 CAGGTGGGAGGGGAGGCCCTGGG + Intronic
1122799679 14:104223361-104223383 GAGGCGGGAGGGCAGGGTCGGGG - Intergenic
1123119756 14:105911205-105911227 CAGGCTGCAGGGAAGGACCAGGG - Intergenic
1124109561 15:26773258-26773280 GAGGCGGGAGGGGAGCGCCCAGG - Intronic
1124232262 15:27955802-27955824 CAGGCGGGAGGAGACCACCCCGG - Intronic
1124412861 15:29451286-29451308 CAGGCGAGAGGCGAGGGCCGAGG - Intronic
1124629545 15:31328552-31328574 CAGGCGAGAGGGCAGCACGGAGG - Intronic
1124632168 15:31344228-31344250 CAGGCTGGAGGGGTGGATCTGGG - Intronic
1124832558 15:33163080-33163102 CAGGCTGGAGTGGAGTACAGTGG - Intronic
1125301531 15:38259294-38259316 CAGGCTGGAGGGCAGTACAGTGG + Intronic
1125629056 15:41132690-41132712 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1125944830 15:43704402-43704424 CAGGAGGGAGGGAAGGTCAGGGG - Intergenic
1127392867 15:58521165-58521187 CAGGGGGAAGGGGAGAACAGAGG - Intronic
1127579180 15:60321698-60321720 AAGGTGGGAGGGTAGGAGCGGGG + Intergenic
1128153469 15:65377596-65377618 CGGGCGCGAGGGGCGGACCCGGG - Intronic
1128736408 15:70056321-70056343 CAGGCTTGAGGGGAGGCCTGTGG + Exonic
1129460905 15:75699698-75699720 CAGGCGGGAGGGCTGGGCCGGGG + Intronic
1129488772 15:75903697-75903719 CAGGCGGGAGTGGAGTGGCGCGG - Intergenic
1129681490 15:77660865-77660887 CAGGCGGGAGGGATGGATGGAGG + Intronic
1130304442 15:82703764-82703786 CAGGCGGGAGGGAAAGAAGGAGG - Intronic
1131255017 15:90856290-90856312 CAGGTGGGAGGGGAGTGCAGTGG + Intergenic
1132496157 16:264442-264464 CAGGTGGGGTGGGAGGACCTGGG + Intronic
1132701848 16:1225342-1225364 CAGGCAGGGCGGGAGGACGGAGG + Intergenic
1132773974 16:1581719-1581741 GAGAGGGGAGGGGAGGAGCGGGG + Intronic
1132897876 16:2237486-2237508 TCGGCGGGAGGGGAGGGGCGGGG - Exonic
1133040912 16:3059380-3059402 CAGCCGGGAGGGAACGACGGGGG - Exonic
1133050708 16:3115823-3115845 CCGGGGGGAGGGGAGGGCTGTGG - Exonic
1133231616 16:4369692-4369714 TGGGCTGGAGGGGAGGACAGAGG - Intronic
1133341143 16:5037024-5037046 CTGGTGGGAGAGGAGGGCCGTGG + Intronic
1133758693 16:8781276-8781298 CAGGAGGTAGGTGAGGAGCGTGG - Intronic
1133869713 16:9675635-9675657 CAGGCGGGAGGGAAAGAAGGAGG + Intronic
1134799532 16:17071594-17071616 GAGAGGGGAGGGGAGGAACGTGG - Intergenic
1134799541 16:17071619-17071641 GAGCGGGGAGGGGAGGAGCGGGG - Intergenic
1134799548 16:17071634-17071656 GGGACGGGAGGGGAGGAGCGGGG - Intergenic
1135295646 16:21277476-21277498 CTGGTGGGAAGGGACGACCGAGG + Exonic
1135302859 16:21345804-21345826 GAGGGGGGAGGGGAGGAGGGAGG - Intergenic
1136590447 16:31215080-31215102 CAGGCAGGAGGCGATGACCGCGG - Exonic
1136608491 16:31352438-31352460 GAGGCAGGAGAGGAGGACCCTGG - Intergenic
1137329181 16:47473106-47473128 CAGGCTGGAGTGGAGTACAGTGG + Intronic
1137636701 16:49993045-49993067 CAGGCCGCAGGGGAGGCCGGAGG + Intergenic
1137773443 16:51036693-51036715 CAGGTGGCAGGGCAGGACCCAGG + Intergenic
1138174968 16:54888823-54888845 CAGGCAGGAAGGTAGGACAGAGG + Intergenic
1138343988 16:56308837-56308859 GAGGAGGAAGGGGAGGACAGTGG + Intronic
1138358557 16:56406040-56406062 GAGGGGGGAGGGGAGGAGAGGGG + Intronic
1139484302 16:67247388-67247410 ATGGCGGGCGGGGAAGACCGCGG - Exonic
1139545758 16:67648802-67648824 GAGGCGGAAGGGCAGGGCCGTGG + Intronic
1140221440 16:73047511-73047533 GAGGAGGGAGGGGAGGACAGAGG + Intronic
1140818044 16:78638644-78638666 CAGGCTGGAGGGAAGGGCGGGGG + Intronic
1141085932 16:81095880-81095902 CAGCCGGGAGGGGAGGCCTGCGG - Intronic
1141464969 16:84199280-84199302 CAGGCGGGAGGGCCGGAGAGGGG + Intergenic
1141497356 16:84419397-84419419 CATAAGGGAGGGGAGGACGGAGG - Intronic
1141675973 16:85517593-85517615 CAGGCGGGGGGAGGGGAGCGTGG - Intergenic
1141705823 16:85663915-85663937 CAGGCGTGAGGGGAGGTGCCAGG + Intronic
1141735590 16:85850311-85850333 CAGGTGGACGGGTAGGACCGAGG - Intergenic
1141996519 16:87639624-87639646 CAGGCGGGAGGCCAGGAGGGAGG - Intronic
1141997408 16:87644333-87644355 CAGGGGTGAGCGGATGACCGCGG - Exonic
1142052082 16:87965409-87965431 CAGGAGGGAGGGCAGCACCGTGG + Intronic
1142175515 16:88643325-88643347 CTGGCGGGAGGGCAGGTCCGGGG + Exonic
1142179694 16:88662440-88662462 CCGGCGCGAGGGGAGGGGCGGGG + Intronic
1142215682 16:88828733-88828755 CAGGTGGGTGGGGAGGTCTGTGG + Intronic
1142246549 16:88972814-88972836 GAGGCGGGAGGTGAGGTCTGAGG + Intronic
1142274828 16:89112922-89112944 GAGCTGGGAGGGGAGGAGCGGGG - Intronic
1142356360 16:89603777-89603799 GAGGCTGGAGGGGAGCACTGGGG + Intergenic
1142582046 17:949013-949035 CAGGGGGGAGAGGAGGAGCCCGG - Intronic
1142600516 17:1051424-1051446 GGGGCGGGAGGGCAGGGCCGGGG + Intronic
1142635383 17:1253928-1253950 CCGGCGGGACGGGAGAACTGGGG + Intergenic
1142762753 17:2051309-2051331 GAGGCGGGGGGTGGGGACCGAGG + Intergenic
1142981410 17:3674269-3674291 CAGGCTGGATGGGAGTGCCGTGG - Intronic
1143033592 17:3981920-3981942 CAGGTGGGAGATGAGGTCCGGGG + Intergenic
1143165351 17:4894679-4894701 CAGCCTGGAGGGGAGCACAGTGG + Intronic
1143269641 17:5666143-5666165 GAGGCTGGAGGAGAGAACCGGGG - Intergenic
1143492267 17:7291399-7291421 GGGGCGGGAGGGGAGGTGCGGGG - Intronic
1143769760 17:9161182-9161204 CAGGCTGGTGGGGTGGAGCGGGG + Intronic
1144347528 17:14362934-14362956 AAGACGGGAGGGGAGGAGAGGGG - Intergenic
1144601009 17:16613309-16613331 CAGGCTGGAGTGGAGCACAGTGG - Intergenic
1144798247 17:17907113-17907135 CAGGGAGGAGGGGAGGGACGAGG + Intronic
1145786435 17:27596978-27597000 CAGGATGGAGAGGAGGAGCGTGG + Intronic
1146178042 17:30679428-30679450 CAGAGGAGAGGGGAGGACAGAGG + Intergenic
1146413132 17:32606058-32606080 CAGGCTGGAGTGGAGTACAGTGG - Intronic
1146688479 17:34857106-34857128 GAGGGGGGTGGGGAGGAACGAGG + Intergenic
1147045222 17:37746284-37746306 CGGGCAGGAGGGGAGGGCGGCGG + Intergenic
1147184363 17:38705552-38705574 CAGGGGGGAGGGAGGGAGCGGGG - Exonic
1147285779 17:39401730-39401752 GGGGCGGGAGGGGAGGAGCGCGG + Intronic
1147743188 17:42680172-42680194 CGGCCGGGAGTGGAGGGCCGCGG + Exonic
1147873641 17:43605341-43605363 GAGGTGGGAGGGGAGGACAGAGG + Intergenic
1148092333 17:45030051-45030073 CTGGCTGGAAGGGAGGACCATGG - Intronic
1148106463 17:45121373-45121395 CTGGCGGGGCGGGAGGACCCGGG + Intronic
1148261896 17:46191999-46192021 AAGGGGGGTGGGGGGGACCGAGG + Intronic
1148698937 17:49576723-49576745 AAGGCGGGAGGGGAGGGACGCGG - Intronic
1148745100 17:49913752-49913774 CAGGTGGGAGGGGTGGATCCTGG + Intergenic
1149684764 17:58528973-58528995 CAGGCAGGAGGTGAGGACCCTGG - Intronic
1150003481 17:61456019-61456041 CAGGCTGGAGGGCAGGGCCCAGG - Intronic
1150246997 17:63683597-63683619 CAGGCGCTGGGGGAGGACCTTGG - Intronic
1150765398 17:67997953-67997975 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
1150830368 17:68512837-68512859 AAGGCGGCCGGGGAGGGCCGCGG - Intronic
1151155414 17:72120849-72120871 GAGGCGGGAGGGGAGGAGAGGGG - Intergenic
1151212219 17:72553088-72553110 AAGGCGGGAAGGGACGACCTTGG + Intergenic
1151422795 17:74009626-74009648 CAGGCGGGAGGTGAGGGTGGAGG - Intergenic
1151622376 17:75254122-75254144 CAGGCGGGAGGGAAAGAAGGAGG - Intronic
1151749095 17:76026873-76026895 CAGGAGGCAGGGGATGACCTGGG - Intronic
1151765775 17:76132574-76132596 CGGGCGGGGGGGGAGGATGGGGG - Intergenic
1152198967 17:78934173-78934195 CATGAGGGAGGGGTGGACAGTGG + Intergenic
1152396492 17:80036310-80036332 CAGGCGGGCTGGGGGCACCGGGG - Intergenic
1152625960 17:81388020-81388042 CAGGCGGGAGAGGAGTTTCGGGG - Intergenic
1152801088 17:82330998-82331020 CTGGGAGGAAGGGAGGACCGGGG - Intronic
1152815251 17:82404124-82404146 CAGGCGGGAGGGGACGCTCGTGG + Intronic
1153795482 18:8618119-8618141 CATCAGGGAGGGGAGGACAGAGG - Intronic
1154091918 18:11372984-11373006 AAGACGGGAGGGGAGGACAGAGG - Intergenic
1154134186 18:11761411-11761433 CAGGCAGGAAGGGAGGTCCATGG - Intronic
1154390566 18:13932984-13933006 CAGGCGGGAGTGGAGGTGCGTGG + Intergenic
1155558608 18:27050345-27050367 CACGGTGGAGGTGAGGACCGTGG + Intronic
1156302140 18:35845439-35845461 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1156331513 18:36128598-36128620 CAGGAGAGAGGCGAGGAGCGGGG + Intronic
1156366977 18:36438497-36438519 CAGGCAGGAGGGGAGGGCCAGGG - Intronic
1156457292 18:37301949-37301971 CAGGCGGGAGGTCTGGACAGTGG - Intronic
1156458332 18:37307154-37307176 CAGGTGGGCGGGGAGCACCCTGG - Intronic
1156924164 18:42556652-42556674 TAGGCGGGAGGGAAGGAAGGAGG + Intergenic
1157474414 18:48012159-48012181 CAGGCAGGAGGGGAGGCCAGGGG + Intergenic
1157906510 18:51574213-51574235 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1158530417 18:58255785-58255807 CAGAACGGAGGGGAGGACGGCGG + Intronic
1158668633 18:59455124-59455146 CAGGGAAGAGGGGAGGACAGAGG + Intronic
1159214638 18:65375111-65375133 AAGGAGGGAGGGGAGGAGCGAGG - Intergenic
1159899031 18:74025107-74025129 GAGGAGGGAGGGGAGGAAAGGGG - Intergenic
1160005990 18:75069379-75069401 CAGGCGGGAGTGGTGGGCCTGGG + Intergenic
1160018668 18:75163854-75163876 TAGGGGCGAGGGGAGGACCATGG + Intergenic
1160094499 18:75859603-75859625 CAGGCGCCAGGGGAGGAACCTGG - Intergenic
1160510760 18:79452210-79452232 CTGGCGGGAGGGGAAGGCCCCGG - Intronic
1160517506 18:79486693-79486715 CAGGCGGGAGTGGAGGAGAGGGG - Exonic
1160682110 19:416647-416669 CAGCTGGGAGGGCAGGACTGGGG + Exonic
1160796614 19:948564-948586 CAGGCGGGAGGAGGGCACGGGGG - Intronic
1160872186 19:1282509-1282531 AAGGAGGGAGGGGAGGAGGGAGG + Intergenic
1160932811 19:1578616-1578638 CAGCTGGGAGGGGAGGCCCGAGG + Intronic
1161022360 19:2016058-2016080 GAGGTGGGAGGGGAGGAGGGAGG + Intronic
1161028765 19:2048495-2048517 CAGGCGGGAGGGGCCCACAGAGG + Intronic
1161161186 19:2762641-2762663 CAGGCTGGAGGAGAGCACCGGGG + Exonic
1161376398 19:3941209-3941231 CGGGCGGGCGGGGGGGACCCTGG + Intronic
1161422640 19:4184302-4184324 CAGGAGGTAGGGGAGGAAGGAGG + Intronic
1161608829 19:5229689-5229711 CGGGCGGGAGGGGAGGGGAGGGG + Intronic
1161783612 19:6309858-6309880 TAGGCGGGAAGGGAGGTCCTGGG + Intronic
1161895241 19:7074947-7074969 CGGGCTGGAGGGGGTGACCGAGG + Intronic
1162027569 19:7903255-7903277 CAGGGGGGAGGGGACGGCCATGG - Intergenic
1162514122 19:11138106-11138128 CGGGAGGGTGGGCAGGACCGGGG + Intronic
1162520819 19:11178444-11178466 CCGCCTGGAGGGGAGGACAGCGG + Exonic
1162870041 19:13579584-13579606 CAGGAGGCATGGGAGGACCCAGG + Intronic
1162921670 19:13906611-13906633 CTGGGGGGAGGCGGGGACCGGGG - Intronic
1162980436 19:14235760-14235782 CAGAGGGGCGGGGAGGACAGAGG - Intergenic
1162995742 19:14333823-14333845 GAGGCTGGAGGGGAAGACCCAGG + Intergenic
1163668462 19:18613850-18613872 CCTGGGGGAGGGGAGGACAGGGG - Exonic
1163815196 19:19460832-19460854 CAGGCCGGAGGGGAGGAATCTGG - Intronic
1163825230 19:19519775-19519797 GAGGCAGGAGAGGAGGACAGAGG - Intronic
1163900389 19:20095142-20095164 CAGGCGGGAGGGAAAGAAGGAGG + Intronic
1164508766 19:28880772-28880794 CAGGCGCTAGGGCAGGACAGGGG - Intergenic
1164615302 19:29664012-29664034 CAGGTGAGAGGGGAGCAGCGGGG - Intergenic
1164634991 19:29785556-29785578 CAGGAGGGAGGGCAGGGCCTGGG + Intergenic
1164729452 19:30491550-30491572 CTGCCGGGAGGGGAGGGCAGGGG - Intronic
1164755445 19:30685760-30685782 CATGATGGAGGGGAGGACGGCGG - Intronic
1165382390 19:35490398-35490420 CAGGAGGGAGAGGAGCACCACGG + Exonic
1166054211 19:40279007-40279029 CAGGCTGGAGAAGAGAACCGGGG + Intronic
1166381339 19:42356808-42356830 CTGGCGGGAGCCGAGGACGGGGG + Exonic
1166872454 19:45879153-45879175 CAGGCAGGAGGGGAAGACACTGG + Intergenic
1167099305 19:47394247-47394269 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1167151573 19:47713358-47713380 CAGGAGGGAGGGGCGGGACGAGG - Exonic
1167265492 19:48480939-48480961 GCGGCGGGAGGGGAGGGCAGAGG + Intronic
1167272259 19:48511990-48512012 CAGGAGGGAGGGGAGGAAATGGG + Intronic
1167414139 19:49361599-49361621 CACGGGGGAGGGGAGGGGCGGGG - Intronic
1167643768 19:50695216-50695238 CGGGAGGGAGGGCAGGGCCGGGG + Intronic
1168328354 19:55550226-55550248 CAGGACGGAGGGGAGGAGAGAGG - Intergenic
1168336555 19:55600430-55600452 CAGGCGGGAGGGGGGGTGTGGGG + Intronic
925030057 2:643402-643424 CAGGCGGGAGGTAAGCACAGAGG + Intergenic
925328410 2:3040163-3040185 CAGGTAGGAAGGGAGGACCAGGG + Intergenic
925625908 2:5841981-5842003 GAGGAGGGAGGGAAGGACGGAGG + Intergenic
925913830 2:8589850-8589872 GAGAGGGGAGGGGAGGACAGGGG + Intergenic
925925435 2:8666794-8666816 CAGGCGGGGGCCGAGGACCAGGG - Intergenic
926077463 2:9952206-9952228 GAGGGGGGCGGGGAGGCCCGGGG - Intronic
926250952 2:11155301-11155323 CGGGCGGGAGGGGCGGGGCGGGG + Intronic
927095661 2:19746035-19746057 CAGCTGGGAGAGGAGGACAGAGG + Intergenic
927134053 2:20083864-20083886 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
927490728 2:23519316-23519338 TGGGGGGGAGGGGAGGACGGGGG - Intronic
929468705 2:42169703-42169725 CAGGCGGGAGGGCAGGGCCTGGG - Intronic
929525945 2:42702997-42703019 CAGGCTGGAGTGGAGTACAGTGG + Intronic
929668481 2:43851878-43851900 AAGGCAGCAGGGGAGGAGCGGGG - Intronic
930108604 2:47658970-47658992 CAGGCAGGAGGGGGAGACGGTGG - Intergenic
931253468 2:60552311-60552333 CGGTCGGGAGGGGAGGGCAGCGG + Intronic
931690972 2:64834522-64834544 CTGGGGGGATGGGAGGACTGAGG + Intergenic
932310002 2:70732111-70732133 CAGGCAGCAGGGGAGAACCCAGG + Intronic
932380315 2:71276432-71276454 CGGGCGCGAGCGCAGGACCGCGG + Intergenic
933770729 2:85742261-85742283 CAGCTGCGAGGGGAGGACCCGGG - Intergenic
933893501 2:86790861-86790883 CGGGCGCGAGGGGAGGCGCGCGG + Exonic
933898599 2:86833526-86833548 CGGACGGGAGGGGAGGAGAGCGG - Intronic
933990316 2:87629024-87629046 CTGGTGGGAGTGAAGGACCGTGG - Intergenic
933992100 2:87641072-87641094 AAGGTGGGAGGGGAGGAGAGGGG + Intergenic
934761787 2:96860729-96860751 CAACTAGGAGGGGAGGACCGGGG - Exonic
934765045 2:96875946-96875968 AAGGAGGGTGGGGAGGACTGAGG + Exonic
935084963 2:99835881-99835903 TGGGAGGGAGGGGAGGACTGGGG + Intronic
936270239 2:111043506-111043528 CAGGTGGGAGGAGAGGGCTGAGG + Intronic
936301744 2:111309746-111309768 AAGGTGGGAGGGGAGGAGAGGGG - Intergenic
936303530 2:111321800-111321822 CTGGTGGGAGTGAAGGACCGTGG + Intergenic
936528009 2:113255209-113255231 AAGGAGGGAGGGGAGGAGGGAGG + Intronic
936528015 2:113255221-113255243 GAGGAGGGAGGGGAGGAGGGAGG + Intronic
936528021 2:113255233-113255255 GAGGAGGGAGGGGAGGAGGGAGG + Intronic
936528032 2:113255256-113255278 GAGGAGGGAGGGGAGGAGGGAGG + Intronic
936528038 2:113255268-113255290 GAGGAGGGAGGGGAGGAGGGAGG + Intronic
936528049 2:113255291-113255313 GAGGAGGGAGGGGAGGAGGGAGG + Intronic
936528055 2:113255303-113255325 GAGGAGGGAGGGGAGGAGGGAGG + Intronic
938157596 2:128954950-128954972 CCAGCGGGAGCGGAGGACAGAGG - Intergenic
938292932 2:130159926-130159948 CCGGCGGCAGGGGCGGACAGTGG - Intronic
938463476 2:131512299-131512321 CAGGGGGGTGGGAAGGACCTGGG + Intergenic
939476009 2:142687144-142687166 CAGAGGGGAGGGGAGGAGAGGGG + Intergenic
939587426 2:144022029-144022051 CAGGGGGGTAGGGAGGACTGAGG + Intronic
941456301 2:165714636-165714658 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
942462624 2:176178682-176178704 CAGGCGCGTTGGGAGGACCCTGG - Intergenic
943450015 2:188034774-188034796 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
944970302 2:204985178-204985200 CAGGCAGGAGGGAAGGAAGGAGG - Intronic
945251604 2:207769607-207769629 AAGGCGGGAGGCGGGGGCCGTGG + Intergenic
946040810 2:216781318-216781340 CAGAGGGGAGGGGAGGGCAGGGG - Intergenic
946333248 2:219022101-219022123 CAGGTGGGAGGGAAGGCCCCAGG - Intronic
946389312 2:219405778-219405800 AAGGCGGGTGGGGAGGACACTGG - Intergenic
946748668 2:222871090-222871112 CAGGAGGCAGGGGATGACAGAGG + Intronic
948893064 2:240916407-240916429 CAGGTGGGCGGGGGGCACCGGGG - Intergenic
949059777 2:241949970-241949992 CAGGGAGGACAGGAGGACCGAGG - Intergenic
1168799594 20:635591-635613 CAGGCAGGAGGGCAGGCCTGGGG - Intergenic
1169038135 20:2470442-2470464 CAGGGGCGAGGGTAGAACCGCGG - Intronic
1169130379 20:3163788-3163810 GTTGCGGGAGGGGAGGACTGGGG - Exonic
1169758809 20:9068963-9068985 CAGGCGGGAGGGCGGGACTGGGG + Intronic
1170101805 20:12709572-12709594 CAGGAGGAAGGGGAGGAATGGGG - Intergenic
1170550353 20:17471102-17471124 AGGGCAGGAGGGGAGCACCGCGG + Intronic
1171173516 20:23035168-23035190 CAGCGGGGAGGGGGCGACCGAGG + Intergenic
1171810139 20:29740909-29740931 CGGGCGGGAGAGGAGGACTGTGG + Intergenic
1172317095 20:33964308-33964330 CAAGGAGGAGGGGAGGACTGTGG + Intergenic
1172483505 20:35285319-35285341 CTGGAGAGAGGGGAGGACTGAGG + Intergenic
1172527315 20:35607651-35607673 GGGGAGGGAGGAGAGGACCGAGG + Intergenic
1172543637 20:35742143-35742165 CACGCGGGAGAGCAGGACGGCGG + Intronic
1172776160 20:37408295-37408317 CAGGCGGGAGGGGTGGAGCAGGG - Intergenic
1172841047 20:37903029-37903051 GAGGAGGGAGGGGAGGAGGGAGG + Intergenic
1172841053 20:37903041-37903063 GAGGAGGGAGGGGAGGAGGGAGG + Intergenic
1172932635 20:38597241-38597263 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1173551912 20:43938323-43938345 CAGGCAGGAGGGGAGGACTAAGG - Intronic
1173741513 20:45405862-45405884 CAGGCGGGGGTGGAGGGGCGAGG - Intronic
1173781566 20:45760984-45761006 CAGGCGGGAGGGAAAGAAGGAGG - Intronic
1174370258 20:50082179-50082201 AGGGCGGGAGTGGAGGAGCGTGG + Exonic
1175215281 20:57389293-57389315 CAGGCGGCAGGGCAGCCCCGGGG - Intergenic
1175248876 20:57597167-57597189 CGGCCTGGAGGGGAGGAGCGCGG - Intergenic
1175402960 20:58711067-58711089 GAGGCGGGGGGGGAGGAGGGAGG - Intronic
1175429512 20:58891644-58891666 CACGCGGGCCGGGAGGGCCGGGG - Intronic
1175831594 20:61967682-61967704 GAGGGGGGAAGGGAGGACGGGGG - Intronic
1175891618 20:62318327-62318349 GACGAGGGAGGGGAGGACGGAGG + Intronic
1175913648 20:62415891-62415913 CAGGGGTGAGGGGGGGTCCGAGG + Exonic
1175956356 20:62611561-62611583 CCGTGGGGAGGGGAGAACCGTGG + Intergenic
1175980830 20:62737850-62737872 GTGGGGGGTGGGGAGGACCGGGG - Intronic
1176109702 20:63405725-63405747 CAGGAGAGAGGGGAGGACTTGGG + Intergenic
1176156949 20:63626828-63626850 GCGGGGGGAGGGGAGGGCCGGGG - Intronic
1176430395 21:6571818-6571840 CAGACGGGAGGGGAAGGCGGAGG - Intergenic
1178001085 21:28162735-28162757 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1179167192 21:38944334-38944356 CAGGCGGGAGGGGAGACCTTGGG - Intergenic
1179570073 21:42273456-42273478 CAGGCGGCAGGGGCGGAGTGGGG - Intronic
1179650481 21:42805201-42805223 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1179705789 21:43179280-43179302 CAGACGGGAGGGGAAGGCGGAGG - Intergenic
1179783607 21:43718110-43718132 CAGGCGGGTGCTGAGGACTGAGG - Intergenic
1179883103 21:44301586-44301608 CAGGTGGGAGAGGAGGCCCGTGG + Intronic
1180104252 21:45607570-45607592 CAGGAGGGAGGGGAGGAGGGAGG + Intergenic
1180156646 21:45981585-45981607 GGGGCGGGAGGGGAGGGGCGGGG - Intergenic
1180156657 21:45981604-45981626 GGGGCGGGAGGGGAGGGGCGGGG - Intergenic
1180915077 22:19480094-19480116 CGGGAGGCAGGGGAGGGCCGGGG + Intronic
1182261305 22:29073997-29074019 TAGGCGGGAGGAGAGGACTGGGG - Intronic
1183014717 22:34976668-34976690 CAGGCGGGAGGGGACTACACAGG + Intergenic
1183075728 22:35425743-35425765 CAAGCAGGACGGGAGGACCTTGG - Intergenic
1183301627 22:37061648-37061670 CTGGAGGGAGGGGTGGAGCGAGG + Intronic
1183466853 22:37984341-37984363 CAGACTGGAGGAGAGGTCCGAGG - Exonic
1183585096 22:38748790-38748812 CACGCGGGAGGGCAGGACGGGGG + Intronic
1183629705 22:39025758-39025780 CAGGCAGGGGGGCAGGACGGAGG - Intronic
1183688554 22:39375646-39375668 CAGGCATCAGGGGTGGACCGGGG + Intronic
1183718018 22:39545606-39545628 CAGGCCGGAGGGGAGAGCCTGGG - Intergenic
1183818682 22:40325824-40325846 CAGGCAGGAGGAGAGGAGGGTGG - Exonic
1184096588 22:42319460-42319482 CAGGAGGCAGGGGAGGTCTGGGG - Intronic
1184109921 22:42388642-42388664 GAGGCGGGAGGGAAGGAGGGAGG + Intronic
1184253920 22:43276433-43276455 CAGGCGGGTGACGAGGACCTGGG + Intronic
1184795869 22:46731995-46732017 GGGTCGGGAGGGGAAGACCGGGG + Intronic
1184941059 22:47765596-47765618 AAGGAGGGAGGGGAGGAAGGAGG + Intergenic
1185102724 22:48850308-48850330 GAGGAGGGAGGGGAGGAAGGCGG + Intronic
949190498 3:1243919-1243941 CAGGCGGGAGGGAAAGAAGGAGG + Intronic
949807671 3:7973659-7973681 CAGGGGAGAGGGGAGGAGAGAGG + Intergenic
950183660 3:10932153-10932175 TAGGAGGGAGGGGAGGAGAGAGG - Intronic
950271152 3:11616200-11616222 CAGGTGGGAGGGGAGGTGGGAGG - Intronic
950675608 3:14552523-14552545 CAGGCAGGAGGTGAGGAGCCAGG - Intergenic
951558551 3:23945002-23945024 CAGCCGGGAGGAGAGGAAAGAGG + Intronic
951972578 3:28463847-28463869 AAGGAGGGAGGGAAGGACAGAGG + Intronic
952788139 3:37176188-37176210 CAGGCGGGCGGGGATGGACGCGG + Intronic
953261725 3:41345920-41345942 CAGGGGGGAGGTGAGGACAGGGG + Intronic
953718544 3:45336018-45336040 AGGGCAGGAGGGGAGGACCCGGG + Intergenic
953848932 3:46450462-46450484 CAAGCAAGTGGGGAGGACCGTGG + Intronic
954025653 3:47781509-47781531 CGGGGGGGAGGGGCGGCCCGAGG + Intronic
954839002 3:53495018-53495040 CAGGGGGGTGGGGAGGGACGGGG - Intronic
955916564 3:63912971-63912993 CAGGGGGGAGGGGAGGAGAGAGG - Intronic
956233614 3:67042871-67042893 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
957515189 3:81240826-81240848 AAGGAGGGAGGGGAGGAGAGAGG + Intergenic
958750891 3:98192516-98192538 CAGGCGGGAGGGAAAGAAGGAGG - Intronic
959368103 3:105488728-105488750 AAGGAGGGAGGGGAGGAAGGAGG + Intronic
959893312 3:111580660-111580682 CAGAGGGAAGGGGAGGACAGAGG - Intronic
960288964 3:115861098-115861120 AAGGAGGGAGGGGAGGAAAGAGG - Intronic
960657151 3:120017640-120017662 CAGTAGGGAGGGGAGGAGAGAGG + Intronic
961463112 3:127065546-127065568 AAGGAGGAAGGGGAGGGCCGAGG - Intergenic
961519969 3:127461410-127461432 CAGGTGGGAGGGAAGGTGCGAGG + Intergenic
961543842 3:127618490-127618512 CGGGCCGGAGGGGAGGACCCTGG - Intronic
961735711 3:129001239-129001261 CAGGCGGGCGGGGCGGAGGGAGG + Intronic
964984981 3:162726673-162726695 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
965373896 3:167897625-167897647 GAGGGGGGAGGGGAGGAGGGAGG + Intergenic
965373910 3:167897649-167897671 GAGGGGGGAGGGGAGGAGGGAGG + Intergenic
967963631 3:194943829-194943851 CAGGCTGGAGTGGAGTACAGTGG + Intergenic
968092972 3:195909599-195909621 GGGGCGGGAGGGGAGGGCCGGGG - Intronic
968509219 4:987998-988020 CAGATGGGAGGGGAGGGCTGGGG + Exonic
968616657 4:1580585-1580607 TAGGCGGGAGGTGGGGCCCGAGG - Intergenic
968673091 4:1862761-1862783 CAGGCAGGAGAAGAGGCCCGCGG - Intergenic
969232440 4:5841185-5841207 GAGGAGGGAGGGGTGGAGCGGGG - Intronic
969354944 4:6619795-6619817 CAGGCACCAGGGGAGGACCTGGG + Intronic
969520721 4:7676301-7676323 CAGGCGGGAGGGGAGGGGGGAGG - Intronic
969597446 4:8157451-8157473 CAGGCGGTTGGGGAGGTCAGAGG - Intronic
970444510 4:16112681-16112703 GAGGAGGGAGGGGAGGAGGGAGG + Intergenic
971412126 4:26384991-26385013 AAGGGGGGAGGGGAGGAGAGGGG - Intronic
977689907 4:99894530-99894552 CGGGGGGGAGGGGAGGGGCGCGG - Intergenic
978000508 4:103552109-103552131 CAGGCTGGAGTGGAGGGCAGTGG - Intergenic
978534269 4:109744485-109744507 CAGGAGGGAGGGAAGGAAAGAGG + Intronic
978917784 4:114147501-114147523 CAGCAGGGAGGGGAGGGCGGTGG + Intergenic
981468258 4:145098607-145098629 TCGGCTGGAGGGGAAGACCGAGG - Intronic
981647828 4:147020084-147020106 CATGCGGGAAGAGAGGACCTAGG - Intergenic
984754676 4:183314079-183314101 CAAGCGGGAGGGCAGGGCCACGG + Intronic
985385354 4:189440713-189440735 AAGGGGGGAGGGAAGGACAGAGG - Intergenic
985528959 5:422556-422578 CAGGAGGGAGTGGGGAACCGGGG + Intronic
985582249 5:704356-704378 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
985675657 5:1230113-1230135 CAGGCTGGAGGGGAGGGAAGAGG + Intronic
985957443 5:3276088-3276110 AAGGAGGGAGGGGAGGAAGGAGG + Intergenic
985957454 5:3276120-3276142 AAGGAGGGAGGGGAGGAAGGAGG + Intergenic
985957469 5:3276168-3276190 AAGGAGGGAGGGGAGGAAGGAGG + Intergenic
985957487 5:3276215-3276237 AAGGAGGGAGGGGAGGAAGGAGG + Intergenic
985957498 5:3276247-3276269 AAGGAGGGAGGGGAGGAAGGAGG + Intergenic
985957509 5:3276279-3276301 AAGGAGGGAGGGGAGGAAGGAGG + Intergenic
985957520 5:3276311-3276333 AAGGAGGGAGGGGAGGAAGGAGG + Intergenic
985957527 5:3276327-3276349 AAGGAGGGAGGGGAGGAAGGAGG + Intergenic
985957534 5:3276343-3276365 AAGGAGGGAGGGGAGGAAGGAGG + Intergenic
985957551 5:3276391-3276413 AAGGAGGGAGGGGAGGAAGGAGG + Intergenic
985957562 5:3276423-3276445 AAGGAGGGAGGGGAGGAAGGAGG + Intergenic
988683103 5:33502627-33502649 CAGGTGGATGGGGAGTACCGGGG + Intergenic
989603963 5:43226314-43226336 CAGGAGGCAGGGAAGGACAGAGG + Intronic
990910048 5:60843911-60843933 CCTGCGCGTGGGGAGGACCGAGG - Intronic
991462784 5:66877065-66877087 GAGGCAGGAGGGGAGGGCCTAGG + Intronic
992068029 5:73125056-73125078 CAGCCTGGAGGGGAGGAACTGGG + Intronic
992104187 5:73436756-73436778 CGGGCGGGAAGGTAGGGCCGCGG + Intergenic
992453687 5:76896165-76896187 CAGGGGGTTGGGGAGGACGGTGG - Intronic
992502883 5:77359130-77359152 CAGCCGGGAGGAGGGGACAGGGG + Intronic
993905708 5:93621234-93621256 CAGGCGGGAGGGGCGGGGAGGGG - Intronic
996201982 5:120686532-120686554 TAGGAGGGAGGGGAGGGCCTTGG - Exonic
996358743 5:122623041-122623063 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
997399430 5:133591095-133591117 CAGGATGGAGGGGAGGACCAGGG + Intronic
997831836 5:137157091-137157113 CAGGAGGGAGGAAGGGACCGGGG - Intronic
998161448 5:139814897-139814919 CAGGCGGGATTGCAGGACCGAGG + Intronic
998183429 5:139961363-139961385 CTGGCAGGAGGGGAGGAGGGGGG - Intronic
998374507 5:141682035-141682057 CAGGAGGGAGGGGCGGGTCGTGG + Intronic
999305337 5:150515832-150515854 CAGGCGGGTGAGGAGGGCCTTGG + Intronic
1000990637 5:167908342-167908364 GAGGGGGGAGGGGAGGAGAGGGG - Intronic
1001963841 5:175896384-175896406 CAGAGGGGAGGGGAGGGCTGGGG - Intergenic
1002026239 5:176397775-176397797 CAGGGGCCAGGGGAGGAGCGCGG - Intronic
1002073609 5:176695327-176695349 CAGAAGGGAGGGGAGGGCAGAGG + Intergenic
1002134013 5:177097226-177097248 CAGGAGGAAGGGGAGGACCGGGG - Intronic
1002300134 5:178253201-178253223 CAGAAGGGAGGGGAGGAGTGTGG - Intronic
1002427540 5:179185116-179185138 GAGGTGGGAGGGGAGCACTGAGG + Intronic
1002444906 5:179284424-179284446 CAGGCTGGAGTGGAGTACAGTGG + Intronic
1002605321 5:180379720-180379742 AAGGAGGGAGGTGAGGACCCGGG - Intergenic
1002928779 6:1619812-1619834 CGGGCGGGAGTGGCGGGCCGCGG - Intergenic
1003020123 6:2502527-2502549 CAGGAGGGATTGGAGGAGCGTGG + Intergenic
1003460874 6:6326696-6326718 CAGGTGGAAGGGAAGGACTGAGG + Intergenic
1004617389 6:17303514-17303536 GAGGGGGGAGGGGAGGGCAGGGG + Intergenic
1005389693 6:25320725-25320747 CAGGTGGGAGGGGTGGACTTTGG + Intronic
1005866668 6:29942682-29942704 CTGGCGGGGGCGCAGGACCGGGG + Intronic
1005959910 6:30687206-30687228 CTGGAGGGAGGGGAGGAGGGAGG + Exonic
1005964455 6:30717167-30717189 AAGGCGGGAGGGGCGTACCTTGG - Intronic
1006155998 6:32013106-32013128 CAGGCGGGAGGGAAAGGCCCTGG - Intergenic
1006162331 6:32045960-32045982 CAGGCGGGAGGGAAAGGCCCTGG - Exonic
1006333945 6:33410941-33410963 GTGGTGGGAGGGGAGGACTGGGG - Exonic
1007100005 6:39239652-39239674 CAGGCGGCAAGGGAGGTCAGGGG - Intergenic
1007273774 6:40658603-40658625 CAGAGGGGAGGGAAGGACAGGGG - Intergenic
1007340043 6:41185646-41185668 GAGAAGGGAGGGGAGGACAGAGG + Intergenic
1007397271 6:41585093-41585115 CATGCAGGGAGGGAGGACCGGGG - Intronic
1007432619 6:41785544-41785566 CAGCCTGGAGGGGAGGAACTGGG + Intronic
1007462889 6:42030870-42030892 AAGGCTGGAGGGGAGGCCCCTGG + Intronic
1008276737 6:49551144-49551166 CATGCGGGTGGAGAGGACCACGG + Exonic
1008576860 6:52869113-52869135 CAGGAGGGAGGGGAGGGGCAAGG - Intronic
1010141908 6:72622202-72622224 CACGCGGGAGGAGAGGAGGGCGG + Exonic
1011543843 6:88463518-88463540 GAGGCGGGAGGTGAAGACAGAGG + Intergenic
1013463784 6:110399932-110399954 CAGCGGGGAGGAGAGGACCGAGG - Intronic
1013808250 6:114016847-114016869 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1014395901 6:120926406-120926428 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1015113383 6:129619328-129619350 AAAGGGGGAGGGGAGGACAGGGG + Intronic
1016075626 6:139792676-139792698 CAGGCTGGAGGGGAGTACGGTGG + Intergenic
1017270228 6:152495320-152495342 CAGAAGGGAGGAGATGACCGCGG - Intronic
1018708913 6:166483698-166483720 CATTCGGGAAGGGAGGACCCAGG + Intronic
1018959947 6:168441120-168441142 CGGGCGGGAGGGGAGGATCCGGG + Intergenic
1019319751 7:410210-410232 GAGGAGGGAGGGGAGGGCTGGGG + Intergenic
1019490556 7:1311295-1311317 CAGGTGGCAGGGGTGGCCCGGGG + Intergenic
1019499038 7:1355296-1355318 CAGGCGGGAGGGAAGGCCTGCGG + Intergenic
1019650773 7:2156774-2156796 CAGGCTGGAGGGCAATACCGTGG - Intronic
1019749400 7:2719243-2719265 CAGGCGGGAGAGGCGGCCGGAGG - Intronic
1020049513 7:5072511-5072533 CATGCTGGAGGGGAGGGGCGAGG + Intronic
1021092024 7:16495442-16495464 GAAGCAGGAGTGGAGGACCGGGG + Intronic
1021393506 7:20122142-20122164 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1021606755 7:22415966-22415988 CAGACAGAAGGGAAGGACCGGGG - Intergenic
1022156077 7:27662932-27662954 CACGCGCGAGGGAAGGAGCGCGG + Exonic
1023260409 7:38353077-38353099 AAGGAGGGAGGGAAGGACGGAGG + Intergenic
1023632829 7:42180572-42180594 AAGGCTGGAGGGTAGGACCCAGG + Intronic
1025661646 7:63560310-63560332 GAGCCGGCAGGTGAGGACCGCGG + Intergenic
1025873938 7:65462450-65462472 CAGACGGGAGGGGAGGCACCAGG - Intergenic
1026941307 7:74289513-74289535 AAGGCGGGAGGCGCGCACCGAGG - Exonic
1026986614 7:74559124-74559146 CAGGGGGGAGGGCAGGACCTAGG - Intronic
1027002387 7:74662565-74662587 CAGGCGGGAGTGTAGGTGCGTGG + Intronic
1027267086 7:76500379-76500401 CAGGCTGGAGAGGAGGCCAGAGG - Intronic
1027318899 7:77000247-77000269 CAGGCTGGAGAGGAGGCCAGAGG - Intergenic
1028121410 7:87059696-87059718 CACGCCGGAGGGAGGGACCGCGG + Exonic
1029252805 7:99249194-99249216 CAGGCAGGTGGGGAGGTCCTGGG - Intergenic
1029476980 7:100791069-100791091 CAGCTGGGAGGTGAAGACCGAGG + Exonic
1031372879 7:120988703-120988725 CCGGCGGGAGCAGAGGACCTCGG - Exonic
1032505004 7:132428025-132428047 CATGGGGGAGGGGAGGACATCGG + Intronic
1032521725 7:132550653-132550675 CTTGAGGGAGGGGAGGACAGGGG - Intronic
1032800266 7:135312168-135312190 CAGGCTGGAGTGGAGTACAGTGG - Intergenic
1033159289 7:138981807-138981829 TCGGCGGGAGAGGAGGAGCGAGG - Intergenic
1033422925 7:141218767-141218789 CAGTGGGGAGGGGAGGACCCAGG - Intronic
1033477064 7:141701844-141701866 CAGGCGCGTGGGGAGGGTCGGGG - Intronic
1033477138 7:141702050-141702072 CAGGCGGGAGGCTGGGGCCGGGG - Exonic
1034270551 7:149801654-149801676 CAGGAGGAAGGGGAGGCCAGGGG + Intergenic
1035027275 7:155834220-155834242 CTGGGGGGATGGGAGGACGGGGG + Intergenic
1035165800 7:156989054-156989076 CAGGAGGGAGGGAAACACCGCGG - Intergenic
1035371803 7:158384344-158384366 CAGCCGGGATGTGGGGACCGCGG + Intronic
1035404355 7:158588060-158588082 CAGGTGGGAGGGGACGCGCGGGG - Intergenic
1035747731 8:1974048-1974070 TAGGCGGGAGGGGAGAAAAGGGG + Intronic
1037084851 8:14836121-14836143 CAGGTGGGAGGGGAGGTGTGGGG - Intronic
1037098018 8:15008710-15008732 GAGGAGGGAGGGGAGGAGGGGGG + Intronic
1037885053 8:22591586-22591608 GAGGCGGGCAGGGAGGACTGGGG - Exonic
1039453982 8:37696190-37696212 CTGACGGGAGTGGAGGACAGCGG - Exonic
1040094626 8:43431850-43431872 CAGGGTGGAGGGGAAGACAGTGG - Intergenic
1041708920 8:60875624-60875646 CAAGCGGGAGGAGAGTACCCTGG - Intergenic
1043769743 8:84183416-84183438 CAGGCAGCGGGGAAGGACCGAGG - Intronic
1044735635 8:95275400-95275422 CAGGCTGGAGTGGAGTACGGTGG - Intergenic
1046722862 8:117640310-117640332 CAGGAGGGTGGGGAGTTCCGAGG - Intergenic
1047208168 8:122819946-122819968 CAGATGGGAGGGGAGGCCTGGGG - Intronic
1048097503 8:131311753-131311775 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1048292372 8:133190890-133190912 CAGGCTGGAGGTGGGGACAGAGG + Intergenic
1049285848 8:141774842-141774864 CTGGCTGGAGAGGAGGACGGAGG - Intergenic
1049440512 8:142607339-142607361 CAGGGGGGAGGGGAGGGGAGGGG + Intergenic
1049585985 8:143432590-143432612 TGGGCGGGAGGGGGGGACAGTGG - Intergenic
1049674761 8:143884498-143884520 CTGGTGGGAGGGCAGGACAGAGG - Intergenic
1049748075 8:144271378-144271400 CAGGTGGGAGAGGCGGAACGAGG - Intronic
1051052511 9:12949886-12949908 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1051642710 9:19238519-19238541 GAGGGGGGAGGGGAGGGCAGGGG - Intronic
1057271527 9:93654300-93654322 CAGGCGGGAGTCGTGGACCTGGG + Intronic
1057812694 9:98269990-98270012 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1057894097 9:98892907-98892929 AAGACGGGATGGGAGGACCAAGG + Intergenic
1058412380 9:104747884-104747906 CCGACGGGAGGGGAGGGGCGGGG + Intronic
1060477885 9:123999512-123999534 GAGGCGGGCGGGGACGGCCGGGG + Intergenic
1060555320 9:124504856-124504878 GAGGCGGGAGGGGGGAGCCGAGG - Intronic
1060933107 9:127501150-127501172 CAGGCGGGTGGGGAGGGCCCCGG - Intronic
1061033569 9:128101257-128101279 CAGGCGCACGGGGAGGCCCGAGG - Intronic
1061213690 9:129208094-129208116 CAGGCTGGAGGGGAGTGCAGTGG + Intergenic
1061348210 9:130043234-130043256 GGGGCGGGAGGGGAGGGGCGGGG + Intergenic
1061491333 9:130946268-130946290 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
1061517095 9:131096403-131096425 GAGGCGGGAGGGGAGGGGAGAGG + Intergenic
1061517104 9:131096422-131096444 GAGGCGGGAGGGGAGGGGCGAGG + Intergenic
1061666393 9:132162927-132162949 AAGGCGGGAAGAGAGGACCGCGG + Intronic
1061677109 9:132223696-132223718 CAGGCGGGACGGGTGGGCCCAGG + Intronic
1061840648 9:133356781-133356803 CAGGAGAGAGGGGAGGGCAGGGG + Intronic
1061919836 9:133776662-133776684 CAGGCGGCAGGGGAGGACAAGGG - Intronic
1061954636 9:133955405-133955427 CAGGGGGGTGGGGAGGAGTGTGG - Intronic
1061976568 9:134070982-134071004 GAGGCTGGAGGGCAGGACAGAGG - Intergenic
1062088220 9:134659635-134659657 CAGGAGGGCAGGGAGGACAGAGG - Intronic
1062207710 9:135346590-135346612 CTGGTGGGAGGGGAGAAACGGGG - Intergenic
1062348105 9:136124786-136124808 CCGCAGGGAGGGGAGGACCTGGG - Intergenic
1185462412 X:339450-339472 CAGGGGTGAGGGGAGGAGCCGGG + Intronic
1186207223 X:7213468-7213490 CAGGCAGGAGGGCAGGAAGGTGG + Intergenic
1187135589 X:16544183-16544205 CAGGCTGGAGTGGAGTACAGTGG - Intergenic
1189002739 X:36963595-36963617 CAGGCGCGCGGCGAGGACCCCGG - Intergenic
1191109345 X:56793016-56793038 CAGGCGGGGTGGGAGGATGGTGG - Intergenic
1192171834 X:68860576-68860598 CAGGAGGGAGAGGATGAGCGGGG - Intergenic
1192206611 X:69100721-69100743 CAGCTGGGAGTGGAGGACCCAGG - Intergenic
1192429595 X:71103212-71103234 CAGCGGGGAGGGGAGGAACAGGG + Exonic
1192592886 X:72375563-72375585 GAGACGGGAGGGGAGGATTGGGG + Intronic
1193834204 X:86322423-86322445 CAGGGTGGAGGGGAAGACAGTGG + Intronic
1194873912 X:99163576-99163598 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1195676829 X:107513019-107513041 CAGGAGGGAGGAGGGGACAGGGG + Intergenic
1196237442 X:113299769-113299791 GAGAGGGGAGGGGAGGAGCGAGG - Intergenic
1196992806 X:121347159-121347181 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1197837925 X:130714866-130714888 GAGGAGGGAGGGGAGCACTGAGG + Intronic
1200143371 X:153913139-153913161 CAGGCGGGAGGGGAGGACCGTGG + Intronic
1200247805 X:154535135-154535157 CAGGCGGGAAGGGAGGGCAACGG + Intronic