ID: 1200143530

View in Genome Browser
Species Human (GRCh38)
Location X:153913745-153913767
Sequence GTCTCCCTCTAACCCCCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200143521_1200143530 15 Left 1200143521 X:153913707-153913729 CCACTTCCAACAGCAGGCTGTAC 0: 1
1: 0
2: 1
3: 13
4: 200
Right 1200143530 X:153913745-153913767 GTCTCCCTCTAACCCCCGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 182
1200143523_1200143530 9 Left 1200143523 X:153913713-153913735 CCAACAGCAGGCTGTACAGGCTC 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1200143530 X:153913745-153913767 GTCTCCCTCTAACCCCCGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200143530 Original CRISPR GTCTCCCTCTAACCCCCGGT GGG Intronic
901280416 1:8029817-8029839 GTCTCACTCTGTCCCCAGGTTGG + Intergenic
902775945 1:18675047-18675069 GTCTCCATCCAAACCCAGGTGGG - Intronic
903019678 1:20385366-20385388 GTCTCCCTGAAACCCCCAGAGGG + Intergenic
903776071 1:25794681-25794703 GTCTCCCTCTATCACCAGGCTGG + Intergenic
904002535 1:27347090-27347112 GTCTCCCTCTATGCCCAGGCTGG - Intronic
906422573 1:45683240-45683262 GTCTCGCTCTGTCCCCAGGTTGG + Intronic
908510879 1:64849217-64849239 GTCTCGCTCTAACACCTGGCGGG + Intronic
916078984 1:161220395-161220417 GTCTCCCTCTATCACCAGGCTGG + Intronic
919366917 1:196673364-196673386 GTCTCCCTCTATCGCCTGGCTGG + Intronic
919776978 1:201200535-201200557 GTCTCCATCTAGTCCCCAGTGGG + Intronic
921967706 1:221108058-221108080 GTCTCCCTCTGTCACCAGGTTGG - Intergenic
1064392992 10:14957661-14957683 GTCTCCCTCTATGCCCAGGCTGG + Intergenic
1064500132 10:15962347-15962369 GTCTCCCTCTATCGCCAGGCTGG - Intergenic
1066560908 10:36668854-36668876 GTCTCACTCTATCCCCTGGCTGG + Intergenic
1066573675 10:36802170-36802192 GTCTCCCACTAAACCCCTGTGGG - Intergenic
1069675130 10:70240816-70240838 GTCTCCCTCTGTCACCAGGTTGG + Intergenic
1071700952 10:87934912-87934934 GTCTCCCTCTATCACCAGGCTGG - Intronic
1071777607 10:88806712-88806734 GTCTCCCTCTGTCACCAGGTTGG + Intronic
1073366627 10:102948021-102948043 GTCTCGCTCTATCCCCAGGCTGG - Intronic
1074972610 10:118551626-118551648 CTCTGCCTCTGACCCCTGGTAGG + Intergenic
1075264367 10:120988258-120988280 GTCTCCCTCTGACCACAGTTGGG + Intergenic
1075743733 10:124712028-124712050 GTCTCCCTCTATCACCAGGCTGG - Intronic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1082068573 11:47920321-47920343 GTCTCGCTCTATCCCCCAGCTGG - Intergenic
1083971061 11:66075766-66075788 GTCTCGCTCTGTCCCCCGGCTGG + Intronic
1084043013 11:66553523-66553545 GTCTCCCTCTTTGCCCCGGCTGG - Intronic
1084215608 11:67645488-67645510 GTCTCCCTCTACCCTCTGGCAGG + Intronic
1085009658 11:73129553-73129575 GTCTCCCACCAACCCCAGATGGG + Intronic
1089326924 11:117663724-117663746 GTTTCCCTCTGATCCCTGGTGGG + Intronic
1091566780 12:1654613-1654635 GTCTCACTGTAACCCCAGGCTGG - Intergenic
1092634621 12:10429523-10429545 GTCTCCCTCTGTCGCCAGGTTGG + Intronic
1092635665 12:10444947-10444969 GTCTCCCTCTGTCGCCAGGTTGG + Intronic
1092814992 12:12304800-12304822 GTCTCCCTCTGTCGCCGGGTTGG - Intergenic
1095503871 12:42871012-42871034 GTCTCCCTCTATCACCAGGCTGG - Intergenic
1098313855 12:69173930-69173952 GTCTTCCCCTATCCCCCAGTTGG + Intergenic
1101630282 12:106486257-106486279 GTCTCCCTCTGACCCCAGGCTGG - Intronic
1101786025 12:107884322-107884344 GCCTCCCTCTAGCCCCAGCTGGG + Intergenic
1105453773 13:20522944-20522966 GTCTCACTCTATCCCCCAGCTGG + Intronic
1105520023 13:21123390-21123412 GTCTCCCTCTGTCACCCGGCTGG + Intergenic
1107531301 13:41284654-41284676 GTCTCCCTCTATCACCAGGCTGG + Intergenic
1111559959 13:89932349-89932371 GTCTCCCTCTCTCCCCAGGCTGG + Intergenic
1112144330 13:96680500-96680522 TCTTCCCTCTAACCCCCGATTGG - Intronic
1112414644 13:99194199-99194221 GTCTCACTCTATGCCCAGGTTGG + Intergenic
1113420604 13:110168815-110168837 GTCTCTCTCTAACACACGTTAGG - Intronic
1114348537 14:21823753-21823775 CTCTCCCCCTAACCCCCGACTGG - Intergenic
1118717722 14:68572247-68572269 GTGTCTCTCAAACCCACGGTGGG + Intronic
1118980936 14:70716261-70716283 GTCTCCCTCTGTCACCCGGCTGG - Intergenic
1119218859 14:72890851-72890873 TTCTGCCTCTAACACCCTGTTGG + Intronic
1119645759 14:76347108-76347130 GTCTCCCTATATCACCCTGTAGG + Intronic
1120257117 14:82134925-82134947 GTCTCCCTCTCACCCAGGCTGGG + Intergenic
1120767825 14:88346941-88346963 GTCTCCCTCTGTCACCAGGTTGG + Intergenic
1122090390 14:99334601-99334623 GCCTTCCTGTAACCCCTGGTTGG - Intergenic
1126788324 15:52197658-52197680 GTCTCCCTCTATCACCCAGGCGG + Intronic
1128652485 15:69428628-69428650 GTCTCGCTCTACCTCCCGGCTGG - Intronic
1128859552 15:71055049-71055071 GTCTCCCTCTATCGCCAGGCTGG + Intergenic
1129224568 15:74161230-74161252 GTCTCTCTCTGAGCCCAGGTTGG + Intergenic
1132732912 16:1371691-1371713 GTCTCACTCTAAGCCCAGGTGGG - Intronic
1132745913 16:1436238-1436260 CCCTCCCTCTACCCCCCGTTGGG - Intronic
1136358077 16:29759657-29759679 GTCTCCCTCTGTCCCCAGGCTGG + Intergenic
1139064150 16:63291662-63291684 GTCTCCCTCTCTCGCCAGGTTGG - Intergenic
1139359633 16:66389617-66389639 CTCTCCCTCTATCCCAGGGTAGG + Intronic
1139735790 16:68986873-68986895 GTCTCACTCTATCCCCAGGCTGG - Intronic
1142206898 16:88787528-88787550 GTCTCCCTCCCACCCCAAGTGGG - Intergenic
1143325042 17:6093143-6093165 GTCTCCCTCATTCCCCAGGTGGG - Intronic
1143561371 17:7697289-7697311 GTCTCCCTCTGTCCCCAGGCTGG - Intronic
1143907088 17:10217610-10217632 GTCTCCCTCTGTCACCCGGCTGG + Intergenic
1144497003 17:15753755-15753777 GTCTCGCTCTGTCACCCGGTTGG + Intergenic
1144516469 17:15920689-15920711 GTCTCCCTCTATCACCAGGCTGG - Intergenic
1144711996 17:17407301-17407323 GTCTCTCTCTAATCTCTGGTGGG - Intergenic
1144904631 17:18631154-18631176 GTCTCGCTCTGTCACCCGGTTGG - Intergenic
1148811292 17:50293250-50293272 GTCTCGCTTTATCCCCAGGTTGG - Intergenic
1148819640 17:50353211-50353233 GTCTCCTTCCAGCCCTCGGTGGG + Intronic
1149407068 17:56363192-56363214 GTCTCCCTCTGTCCCCAGGCTGG - Intronic
1149495605 17:57115527-57115549 GTCTGCCTCTGACCCACAGTGGG + Intronic
1149578253 17:57728933-57728955 ATCTCCATCAAACCCCTGGTGGG - Intergenic
1150771765 17:68048166-68048188 GCCTCCCTCTAACTCCCCATGGG + Intergenic
1151596424 17:75080562-75080584 GTCTCCCTCTGTCCCCAGGCTGG - Intergenic
1152190996 17:78887412-78887434 GTCTCCCTCTGTCCCCAGGCTGG + Intronic
1152977835 18:240875-240897 GTCTCCCACCAACCCCAGATGGG - Intronic
1153572055 18:6483310-6483332 GTCTCGCTCTGACACCAGGTTGG + Intergenic
1153666990 18:7375215-7375237 TTCTCCCTCCATCCCCAGGTTGG + Intergenic
1153727857 18:7976137-7976159 GTCTCCCTCTGTCTCCCGGCTGG - Intronic
1156297153 18:35803101-35803123 GTCTCACTCTGTCCCCCGGCTGG + Intergenic
1159258609 18:65980902-65980924 GTCTCGCTCTATCCCCAGGCTGG + Intergenic
1159399097 18:67906918-67906940 GTCTCACTCTATCCCCAGGCTGG - Intergenic
1160183024 18:76651910-76651932 GTCTCCCTCTGTCACCAGGTTGG - Intergenic
1161488584 19:4549329-4549351 GTCTCCCTCTGGCCCCAGGTTGG + Intronic
1161495718 19:4584686-4584708 GGCTCTCTTTAACCCCAGGTTGG + Intergenic
1164008919 19:21179587-21179609 GTCTCGCTCTGACCCCAGGCTGG + Intronic
1164916963 19:32059374-32059396 GTCTCCCTCTGTCCCCAGGCTGG - Intergenic
1165167034 19:33863982-33864004 GTCTCGCTCTGTCCCCAGGTTGG + Intergenic
1166811916 19:45519623-45519645 GTCTCGCTCTGTCCCCAGGTTGG + Intronic
1167343779 19:48932414-48932436 GTCTCACTCTATCCCCAGGCTGG - Intergenic
1167433710 19:49467045-49467067 GTCTCCCTCTGGCACCCGGCTGG + Intronic
1167874069 19:52397064-52397086 GTCTCCCTCTGTCCCCCAGGCGG - Intergenic
925714984 2:6775700-6775722 GTCTCCCTCTGTCACCAGGTTGG - Intergenic
929094240 2:38248545-38248567 ACCTCCCTCTAACCCCAGCTGGG + Intergenic
929530482 2:42748056-42748078 GTCTCCCTCTGTCGCCAGGTGGG + Intronic
930016104 2:46971566-46971588 GTCTCACTCTAATCCCCAGGGGG - Intronic
932647760 2:73522497-73522519 GTCTCACTCTATCTCCAGGTTGG + Intronic
933890735 2:86767091-86767113 GTCTCCCTCTGTCCCCTGGCTGG + Intronic
938620384 2:133046406-133046428 GTCTCCCTCTGTCCCCAGGCTGG + Intronic
942860919 2:180611079-180611101 GTTTCACTCAAACCCCGGGTAGG + Intergenic
944243847 2:197511920-197511942 GTCTCACTCTATCGCCAGGTTGG - Intronic
945234913 2:207625120-207625142 GTCTCCCTCTCACCCCTGGAGGG - Exonic
948037343 2:234868892-234868914 GTCTCGCTCTATCACCAGGTTGG - Intergenic
948698144 2:239744056-239744078 CTCTCCCTCTGACCCCCATTTGG - Intergenic
1170383415 20:15787458-15787480 CTCTCCCTCCATCCCCCAGTAGG + Intronic
1170490232 20:16864984-16865006 GACTACCTCTAATCCCTGGTAGG + Intergenic
1171422202 20:25024848-25024870 GTATCTCTCTGACCCCCGGATGG - Intronic
1171863373 20:30422086-30422108 GTCTCGCTCTGTCCCCAGGTTGG + Intergenic
1175239362 20:57535447-57535469 GCCTCCCTCTGACCCATGGTGGG - Intergenic
1175346268 20:58278908-58278930 GTCTCCCTCTGTCCCCAGGCTGG + Intergenic
1176358023 21:5968944-5968966 GTCTCCCTCTGTCCCCAGGCTGG - Intergenic
1176693693 21:9948844-9948866 GTCTCCCTCTGTCCCCAGGCTGG + Intergenic
1177051767 21:16244412-16244434 GTCTCCCTCTGTCACCAGGTTGG - Intergenic
1177318744 21:19493815-19493837 GCCTCCCCCTAACCCGCCGTGGG + Intergenic
1177449324 21:21244815-21244837 GTCTCACTCTGTCCCCAGGTAGG - Intronic
1178458141 21:32775309-32775331 GTCTCACTCTATCCCCAGGCTGG + Intergenic
1179765495 21:43569607-43569629 GTCTCCCTCTGTCCCCAGGCTGG + Intronic
1182042620 22:27250129-27250151 GTCTCACTCTGTCCCCAGGTTGG - Intergenic
1182839343 22:33373942-33373964 GTCTCACTCTATCCCCAGGCTGG - Intronic
1184351782 22:43949112-43949134 GTCTTGCTCTGACACCCGGTGGG - Intronic
1184935714 22:47718921-47718943 GTCTCGCTCTATCCCCCAGCTGG + Intergenic
1185222319 22:49635276-49635298 TTCTCTCTCTATCCCCTGGTGGG - Intronic
1185372539 22:50467690-50467712 GTCTCCCCCTGACCCCCAGCAGG - Exonic
953454970 3:43033625-43033647 GTCACCATCTAACCTCAGGTGGG - Intronic
965800101 3:172483553-172483575 GTCTCCCTCTGTCACCAGGTTGG - Intergenic
967164746 3:186770645-186770667 GTCTCACTCTATCACCCGGCTGG + Intergenic
967352321 3:188527318-188527340 GTCTCCCTCTGTCCCCAGGCTGG - Intronic
967702134 3:192605349-192605371 GTCTCCCTCTTTCCCCAGGCTGG - Intronic
970563911 4:17312415-17312437 GTCTCTCTCTGACCCCAGGCTGG + Intergenic
971302260 4:25451346-25451368 GTCTCACTCTAGTGCCCGGTTGG - Intergenic
972420859 4:38885002-38885024 GTCTCCCTCTATCGCCAGGCTGG + Intronic
976849923 4:89533145-89533167 GTCTCCATCTAACAGCCAGTAGG - Intergenic
977429447 4:96912702-96912724 GTCTCACTCTATCACCCGGCTGG - Intergenic
980910497 4:138989650-138989672 GTCTCCCTCTGTCCCCAGGCTGG - Intergenic
980954605 4:139415480-139415502 GTCTCGCTCTATCCCCTGGCTGG + Intronic
982741563 4:159062130-159062152 CCCTCCTTCTAACCCCTGGTAGG - Intergenic
983823736 4:172230549-172230571 GTCTCACTCTATCGCCCGGCTGG - Intronic
987604294 5:20112682-20112704 GTCTCCCTCTATCGCCAGGCTGG - Intronic
992464990 5:76994997-76995019 GTCTCGCTCTATCGCCAGGTTGG - Intergenic
993257091 5:85605365-85605387 GTTTCCCTCTAGCCCAGGGTAGG - Intergenic
993472654 5:88324632-88324654 GTCTCACTCTATCGCCAGGTTGG - Intergenic
994700252 5:103124248-103124270 GTCTCGCTCTGTCCCCAGGTTGG - Intronic
998001998 5:138632857-138632879 GTCTCGCTCTATCACCCGGCTGG + Intronic
999483747 5:151972289-151972311 GTCTCGCTCTATCCCCAGGCTGG - Intergenic
999531738 5:152470584-152470606 ATCTCCCTCTGACCCCAGGTAGG - Intergenic
1000866946 5:166525602-166525624 GTCTCACTCTAACACCAGGCTGG + Intergenic
1001637364 5:173220869-173220891 GTCTCCCTCTATCACCCAGCTGG + Intergenic
1001726361 5:173905362-173905384 GTCTCGCTCTAACGCCAGGCTGG + Intronic
1006237973 6:32652249-32652271 GTCTCCCTCTGTCCCCAGGCTGG - Intergenic
1006531560 6:34659649-34659671 GTCTCACTCTATCCCCAGGCTGG + Intronic
1006631503 6:35433420-35433442 GTCTCCCTCTATGCCCAGGCTGG - Intergenic
1006706622 6:36026656-36026678 GTCTCCCTCTGACGCCAGGCTGG + Intergenic
1008273881 6:49520818-49520840 GTCTCCCTATAAGTCCAGGTTGG - Intronic
1010200391 6:73276635-73276657 GTCTCCTTCTGACCCCAGGTTGG - Intronic
1011628224 6:89300468-89300490 GTCTCACTCTATCACCCGGGTGG - Intronic
1011745095 6:90401348-90401370 GTCTCCCTCTGTCACCCGGCTGG + Intergenic
1016702069 6:147065357-147065379 GTCTCCCTCCATCGCCCGGCTGG + Intergenic
1019542289 7:1556974-1556996 GTCTCCCTCTGTCCCCAGGCTGG - Intronic
1020246770 7:6435454-6435476 GTCTCCCTCTGTCGCCCGGCTGG - Intronic
1025201246 7:56963115-56963137 CACTCCCTCCAACCCCCTGTTGG - Intergenic
1025670698 7:63613818-63613840 CGCTCCCTCCAACCCCCTGTTGG + Intergenic
1026041306 7:66870482-66870504 GTCTCCCTCTATCCCAGGCTGGG + Intergenic
1026133397 7:67638535-67638557 GTCTCTCTCAAACCCCCTTTTGG - Intergenic
1026265004 7:68788484-68788506 GTCTCGCTCTATCCCCAGGCTGG - Intergenic
1026312558 7:69199797-69199819 GTCTCCCTCTAGCCCACCCTTGG + Intergenic
1031824764 7:126550142-126550164 GTCTCCCTCTGTCCCCAGGCTGG + Intronic
1032698895 7:134361527-134361549 GTCTCCCAATCACCCCCGGATGG - Intergenic
1032714394 7:134492904-134492926 GTCTCACTCTATCACCCAGTGGG + Intergenic
1036150711 8:6294797-6294819 GTCTCCCTCTGTCACCAGGTTGG - Intergenic
1036188845 8:6650908-6650930 GTCTCCCTCTGTCACCCGGCTGG + Intergenic
1044687832 8:94844780-94844802 GTCTCACTCTATCACCCAGTTGG + Intronic
1047394046 8:124478111-124478133 GTCTCACTCTATCCCCAGGCTGG - Intronic
1049263444 8:141652354-141652376 GCCTCCCTCTAACCCCGAGGTGG + Intergenic
1053630659 9:39934938-39934960 GTCTCCCTCTGTCCCCAGGCTGG + Intergenic
1053775107 9:41528567-41528589 GTCTCCCTCTGTCCCCAGGCTGG - Intergenic
1054213228 9:62315760-62315782 GTCTCCCTCTGTCCCCAGGCTGG - Intergenic
1059134613 9:111793879-111793901 GTCTCCCTCTGTCCCCAGGCTGG + Intronic
1060597379 9:124856533-124856555 GTGTCCCTCTAGCGCCTGGTGGG - Exonic
1060974615 9:127757298-127757320 GTATCCCTCTGTCGCCCGGTTGG + Intronic
1061623145 9:131824588-131824610 GTCTCCCTCTAAGCTCCAGTAGG - Intergenic
1185661365 X:1731488-1731510 GTCTCACTCTATCACCCGGCTGG + Intergenic
1192113433 X:68388429-68388451 GTCTCCCTCTATCACCCAGTCGG - Intronic
1196214488 X:113034966-113034988 GTCTCCCTCTAGCCCAAGGCAGG + Intergenic
1196408412 X:115390873-115390895 GTCTCACTCTATCCCCAGGCTGG + Intergenic
1196687282 X:118522287-118522309 GTCTCACTCTGACCCCAGGCTGG - Intronic
1197215093 X:123859969-123859991 GTGTCCCTCCCACCCCCGGCCGG - Intronic
1199600016 X:149536271-149536293 TTCTGCCTCTAACCCCATGTTGG - Intergenic
1199650618 X:149943980-149944002 TTCTGCCTCTAACCCCATGTTGG + Intergenic
1200143530 X:153913745-153913767 GTCTCCCTCTAACCCCCGGTGGG + Intronic