ID: 1200146369

View in Genome Browser
Species Human (GRCh38)
Location X:153928280-153928302
Sequence GCGCGCGAGCCCAGTGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200146358_1200146369 15 Left 1200146358 X:153928242-153928264 CCGACGCAGTGCGCAAGCCCGCC 0: 1
1: 0
2: 0
3: 5
4: 38
Right 1200146369 X:153928280-153928302 GCGCGCGAGCCCAGTGCCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 73
1200146359_1200146369 -2 Left 1200146359 X:153928259-153928281 CCCGCCCTTCCCCCGCACCCTGC 0: 1
1: 0
2: 9
3: 124
4: 1251
Right 1200146369 X:153928280-153928302 GCGCGCGAGCCCAGTGCCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 73
1200146360_1200146369 -3 Left 1200146360 X:153928260-153928282 CCGCCCTTCCCCCGCACCCTGCG 0: 1
1: 0
2: 2
3: 51
4: 751
Right 1200146369 X:153928280-153928302 GCGCGCGAGCCCAGTGCCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 73
1200146361_1200146369 -6 Left 1200146361 X:153928263-153928285 CCCTTCCCCCGCACCCTGCGCGC 0: 1
1: 0
2: 0
3: 21
4: 300
Right 1200146369 X:153928280-153928302 GCGCGCGAGCCCAGTGCCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 73
1200146357_1200146369 26 Left 1200146357 X:153928231-153928253 CCGGGGCGCGGCCGACGCAGTGC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1200146369 X:153928280-153928302 GCGCGCGAGCCCAGTGCCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 73
1200146362_1200146369 -7 Left 1200146362 X:153928264-153928286 CCTTCCCCCGCACCCTGCGCGCG 0: 1
1: 0
2: 0
3: 33
4: 273
Right 1200146369 X:153928280-153928302 GCGCGCGAGCCCAGTGCCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200146369 Original CRISPR GCGCGCGAGCCCAGTGCCGC CGG Intronic
900314468 1:2050188-2050210 GCGCGCGGTCCCATTGGCGCAGG + Intergenic
903044167 1:20553340-20553362 CCGTGCGAGCGCAGCGCCGCCGG + Exonic
905630370 1:39515005-39515027 CAGCGCGAGCCCTGAGCCGCCGG - Intronic
905667389 1:39771184-39771206 CAGCGCGAGCCCTGAGCCGCCGG + Exonic
915287828 1:154864116-154864138 GCCTGCGAGCCCACTGCCGAGGG - Intronic
919748652 1:201023565-201023587 GCGCGCGGGCCCAGCCCCGGGGG - Exonic
1070774771 10:79103260-79103282 GCCCTCGAGCCCCGTGCAGCTGG - Intronic
1071078755 10:81784499-81784521 GCGCAGGAGCCCAGGGCAGCGGG - Intergenic
1073249715 10:102114297-102114319 GTGCCCCAGCCCAGAGCCGCCGG - Intronic
1074618543 10:115093710-115093732 GCCCGCGAGCGCAGTCTCGCCGG + Exonic
1074884475 10:117683773-117683795 GGGCGAGAGCCCAGTGGCGGTGG - Intergenic
1077360792 11:2139431-2139453 CCGCGCGGGCCCTGGGCCGCGGG - Intronic
1083747779 11:64745020-64745042 GCCCGGGAGGCCAGGGCCGCGGG + Intronic
1088094093 11:106077775-106077797 GCTCGGCAGCCAAGTGCCGCAGG - Exonic
1089359586 11:117876869-117876891 GCGCGCGAGCACAGAGCGGGAGG - Exonic
1089543629 11:119206188-119206210 GCGCGCGAGCCCGGGGCGGGCGG - Exonic
1102024581 12:109706987-109707009 GGGAGGGAGCCCAGTGCAGCTGG + Intergenic
1103698626 12:122835890-122835912 GCGCTCGGGCCCAGAGGCGCCGG + Intronic
1103698666 12:122836000-122836022 GTGCGCGAGCCCAGCGCGCCGGG + Intronic
1103889488 12:124227998-124228020 GCCTGGGAGCCCAGTGACGCAGG - Intronic
1104938385 12:132379734-132379756 GCGCGACAGCCCAGGGCCACGGG - Intergenic
1125070343 15:35546441-35546463 GAGCCCAAGCCCAGTGGCGCAGG + Intergenic
1133311200 16:4847764-4847786 GCGCGGGAGCCCAGACCCGGCGG - Intronic
1142395407 16:89828773-89828795 GCGCGGGAGCCCGAGGCCGCGGG + Exonic
1142560391 17:806034-806056 GAGCGCAGGGCCAGTGCCGCCGG + Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1144021023 17:11240583-11240605 GCGAGCGAGCGGAGAGCCGCCGG - Intergenic
1146053292 17:29568624-29568646 GCGCGCGAGCCCAGGGCCAACGG + Exonic
1147869781 17:43579082-43579104 GAGAGCTAGCCCAGTGCCCCTGG + Intronic
1148225470 17:45895641-45895663 GCGCGCCAGCCCCGCGCCTCCGG - Intronic
1148852719 17:50562456-50562478 CCGCTAGAGCCCAGTGCCGCGGG + Intronic
1150692747 17:67378853-67378875 GCGCGCGAGCCGGGAGCGGCGGG + Intronic
1151535483 17:74736871-74736893 GCGCCCGAGCCCCGGGCCGTGGG - Intronic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1155284205 18:24271867-24271889 GCGCGGGAGTCCTGGGCCGCTGG - Intronic
1158976577 18:62715975-62715997 GCGCCCCAGCCCATTGCCGGCGG + Exonic
1162932354 19:13963360-13963382 TCGCGCCAGCCCAGTGACTCAGG + Intronic
1165058513 19:33194103-33194125 GCGCTCCAGCCCAGTGCTCCAGG - Intronic
1165079997 19:33301681-33301703 GCGCCCGCGCTCGGTGCCGCCGG - Exonic
1168305619 19:55433542-55433564 GCGCGCGCGCCTGGTGTCGCAGG - Exonic
1168641395 19:58034084-58034106 GCGAGCGCGCCCAACGCCGCGGG - Exonic
927653545 2:24927119-24927141 GCGCGCGAGCCCTGCCCCTCCGG + Intergenic
930700801 2:54456606-54456628 GGGCGCGGGCCCAGGGCCGGAGG + Intronic
938301137 2:130213739-130213761 GCGCGGGCGCCCAGTGGCGGGGG - Intergenic
939886398 2:147686342-147686364 GTGCGGGAGCCCACTGCGGCGGG + Intergenic
941112273 2:161428108-161428130 GCACCCGAGCCCAGAGCAGCGGG + Intronic
1173231818 20:41204402-41204424 GCGGGTGAGCCCAGTGCTGAAGG - Exonic
1173454029 20:43189575-43189597 GCGCGCGGGCCCCCAGCCGCGGG - Intronic
1175903015 20:62367378-62367400 GCGCCCGAGCCCCGAGCCCCGGG + Intergenic
1181270787 22:21657497-21657519 GCGCGCGTGCCCAGAGCAACGGG + Intronic
1183683670 22:39349896-39349918 TCGCGGGAGCCCTGGGCCGCCGG + Intergenic
1183788408 22:40045217-40045239 GAGCGCGCGCTCAGCGCCGCCGG - Intronic
1184766975 22:46577183-46577205 GCCCGGGAGCCCAGCGGCGCCGG - Intronic
1184932328 22:47690552-47690574 GCTCTCGAGCCCAGTGGAGCTGG - Intergenic
950282383 3:11719420-11719442 GCGGGCGCGCCCAGAGCCGCCGG - Intronic
972543205 4:40056920-40056942 GCGGGAGAGCGCAGTGGCGCCGG + Exonic
973686766 4:53377988-53378010 GCGCGAGAGGCCAGGGACGCCGG - Intronic
976431353 4:84966333-84966355 GCCCGGGAGCCCCGCGCCGCGGG + Exonic
978384689 4:108167904-108167926 GCGGGCGAGCGCGGGGCCGCCGG + Exonic
989963381 5:50441248-50441270 GCGCTCGCAGCCAGTGCCGCGGG + Exonic
991371557 5:65925555-65925577 GCACGCGAACCCACGGCCGCCGG + Intergenic
992487473 5:77210522-77210544 GCGCCCTGGCCCAGGGCCGCGGG + Intronic
1003171667 6:3725575-3725597 GCCTGTGAGCCCAGTGCCGCCGG - Intronic
1007897459 6:45377664-45377686 GCGCGGGGGCCCAGCGACGCTGG + Intronic
1019563930 7:1670510-1670532 GCGCGCGATCCGAGCGCAGCGGG + Intergenic
1022230687 7:28409836-28409858 GCGCGCGAGTCCCCTGACGCGGG + Intronic
1022427942 7:30285523-30285545 GCGCACCAGCCCAGCGCCTCCGG + Exonic
1026516607 7:71078270-71078292 ACGCAGGAGCCCACTGCCGCGGG - Intergenic
1043401781 8:79891658-79891680 GCGCGGGCGCCCAGTGCTGGGGG - Intergenic
1045459433 8:102412905-102412927 GCTCCCGAGCCCAGCCCCGCCGG + Intergenic
1052014832 9:23452126-23452148 GAGCGCCCGGCCAGTGCCGCTGG + Intergenic
1055030662 9:71769062-71769084 GCGCCCGAGCGCACTGCCGGCGG + Intronic
1055321627 9:75088312-75088334 GTGCGCCAGTGCAGTGCCGCGGG - Intergenic
1060643861 9:125261775-125261797 GCGCGCGTGCGCAGCGCCGCGGG - Intronic
1060816774 9:126639235-126639257 GGGCTGGAGCCCAGTGGCGCTGG + Intronic
1060982723 9:127803020-127803042 GAGCGCGTGGCCGGTGCCGCAGG + Exonic
1190285417 X:48957958-48957980 GCGCGCGTGCGCAGCGCCCCGGG - Intronic
1200146369 X:153928280-153928302 GCGCGCGAGCCCAGTGCCGCCGG + Intronic
1200306069 X:155027084-155027106 GCGCGCGCGGCCGGCGCCGCGGG + Intronic