ID: 1200146432

View in Genome Browser
Species Human (GRCh38)
Location X:153928539-153928561
Sequence GCACGTGACCAGCAGGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200146432_1200146438 18 Left 1200146432 X:153928539-153928561 CCGGCTGCCTGCTGGTCACGTGC 0: 1
1: 0
2: 5
3: 31
4: 201
Right 1200146438 X:153928580-153928602 AACCGAGCTCCAGGCCTGTGTGG 0: 1
1: 0
2: 1
3: 13
4: 145
1200146432_1200146436 9 Left 1200146432 X:153928539-153928561 CCGGCTGCCTGCTGGTCACGTGC 0: 1
1: 0
2: 5
3: 31
4: 201
Right 1200146436 X:153928571-153928593 GCCAAAGAGAACCGAGCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200146432 Original CRISPR GCACGTGACCAGCAGGCAGC CGG (reversed) Intronic
900202904 1:1419325-1419347 ACCCCTGTCCAGCAGGCAGCCGG + Exonic
901081895 1:6588375-6588397 GCACGTGGCCAGCCGCCATCAGG + Exonic
902570159 1:17342093-17342115 GGACGTGTCCAGCAGGGAGATGG - Exonic
902927449 1:19705612-19705634 GCATGTGGCCAGCAGGCCACTGG + Intronic
905792062 1:40795030-40795052 GCACTGGACCGGGAGGCAGCAGG + Intronic
905930580 1:41784079-41784101 GCACATGACAATCAGGCAGGAGG + Intronic
906145777 1:43559246-43559268 ACACGTTACCATCAGGCAGTGGG + Intronic
906458405 1:46018350-46018372 GGAGGAGTCCAGCAGGCAGCTGG - Intronic
907300127 1:53481841-53481863 GTAGGAGACCAGCAGGCAGGAGG - Intergenic
908124446 1:61016317-61016339 GAACGTGACATGCGGGCAGCTGG + Intronic
908977802 1:69919874-69919896 GCCACTGGCCAGCAGGCAGCGGG - Intronic
911589888 1:99734846-99734868 GGACGAGACCAGCCTGCAGCTGG + Intronic
914244169 1:145873373-145873395 CCTTCTGACCAGCAGGCAGCTGG + Exonic
915072046 1:153278057-153278079 GCTCTTCACCAGCAGGGAGCAGG - Intergenic
915075422 1:153304576-153304598 GAAAGTGACCAGAAGGCAGCAGG - Intronic
916202392 1:162284349-162284371 ACATCTGACCAGCAGGCAGGTGG + Intronic
919687421 1:200497136-200497158 GTCAGTCACCAGCAGGCAGCAGG - Intergenic
921372159 1:214435052-214435074 GCATGTGGCCCGCAGGCTGCGGG + Intronic
922356742 1:224783430-224783452 GGAAGTGGTCAGCAGGCAGCAGG + Intergenic
923076370 1:230612417-230612439 GCAGGTGATCTGCAGGCAACCGG + Intergenic
923625004 1:235606665-235606687 GCACATGGCCAGCAGACAGGAGG + Intronic
923715532 1:236421949-236421971 GCACTTGACCAGGAGGGAGAGGG + Intronic
924947893 1:248858267-248858289 GGACGTGTCCTGCAGGCGGCGGG - Exonic
1063536296 10:6886941-6886963 GCATGTGTCCTGCAGGCTGCGGG - Intergenic
1064143176 10:12807135-12807157 GAAGGTAGCCAGCAGGCAGCTGG - Intronic
1065367925 10:24952881-24952903 GCACGCGACCATCCGGCAGGGGG - Intergenic
1069927249 10:71859281-71859303 GCATGTGACCTGCAGGCCGTGGG - Intergenic
1070849227 10:79550091-79550113 GCACATGACAGGCAGGCGGCAGG + Intergenic
1070924626 10:80210999-80211021 GCACATGACAGGCAGGCGGCAGG - Intergenic
1075483083 10:122798920-122798942 CCACGTGGTCTGCAGGCAGCTGG + Intergenic
1076022794 10:127088411-127088433 GCACATAACCACTAGGCAGCTGG - Intronic
1076836043 10:133021390-133021412 GCCCGTGCCCAGTCGGCAGCGGG - Intergenic
1076922225 10:133459971-133459993 GCACGTGGTCTGCAGGCAGCTGG + Intergenic
1078139205 11:8679751-8679773 GCATGTGACCAGCAGGAAGAGGG - Intergenic
1078480322 11:11669655-11669677 GCATGGGAGCAGAAGGCAGCGGG + Intergenic
1080785586 11:35472429-35472451 GCACGTGCCTAGCTGGTAGCTGG - Intronic
1081874316 11:46398189-46398211 GCACTGGCCCAGAAGGCAGCAGG + Intronic
1083142108 11:60730444-60730466 GCACGTGCCCTGCAAGGAGCTGG + Intronic
1083610378 11:64001396-64001418 GCCTGTGAGCACCAGGCAGCTGG - Intronic
1084179370 11:67438808-67438830 CTACGTGCCCAGCAAGCAGCGGG - Exonic
1089253743 11:117182640-117182662 GCTCTTCCCCAGCAGGCAGCAGG + Intronic
1089644582 11:119870306-119870328 GGAGGTGACCAGCAGGCAGCTGG - Intergenic
1090268400 11:125369298-125369320 GCTCTCCACCAGCAGGCAGCTGG - Intronic
1090436309 11:126689525-126689547 CCAGGTGACAAGAAGGCAGCTGG - Intronic
1090446647 11:126770169-126770191 GCCCTTGACAAGCAGGAAGCAGG - Intronic
1091835387 12:3582183-3582205 TCACGGGGCCAGCAAGCAGCAGG + Intronic
1094199372 12:27780656-27780678 GGACGTGACCTGCAGGAAGGAGG - Exonic
1095498226 12:42807911-42807933 GAATGTGACCAGCAGACAGTGGG + Intergenic
1096490993 12:52012945-52012967 GCAGGTGAGCAGCACCCAGCTGG - Intronic
1096498474 12:52051816-52051838 GGACTTGTCCAGCAGGCGGCTGG + Intronic
1096567287 12:52492493-52492515 GCTGGTGCCCAGCAAGCAGCAGG - Intronic
1100565652 12:95790970-95790992 GACCGGGACCAGCGGGCAGCCGG - Intronic
1100856846 12:98764826-98764848 GCACTGCACCAGCAGCCAGCAGG - Intronic
1102052463 12:109872609-109872631 GCACGGCACCAGCACACAGCAGG + Intronic
1102471662 12:113162998-113163020 GCCTTTGAGCAGCAGGCAGCTGG - Exonic
1102545029 12:113648253-113648275 GCACTGCACCAGCAGCCAGCAGG - Intergenic
1102898939 12:116621147-116621169 GCAGGTGACAAGGAGGCAGCGGG - Intergenic
1103331939 12:120160198-120160220 GCAGCTGACCAGCAAGCAGAAGG - Exonic
1103749787 12:123150878-123150900 GCCCGGGGCCAGCAGGCGGCGGG - Intergenic
1104630803 12:130400471-130400493 GCAGATGACCAGCAGGCAGATGG - Intronic
1104901259 12:132190588-132190610 GCACGACGCCAGCAGGCACCGGG - Intergenic
1105784665 13:23736693-23736715 GGACTTGACCTGCAGACAGCTGG + Intronic
1105968329 13:25404758-25404780 GCAGGTGTCCAGCAGGCAGCTGG + Intronic
1108460684 13:50664737-50664759 GCAAATGACCTGCAGGTAGCAGG - Intronic
1113375622 13:109762725-109762747 GGACCTGACCAGCAGGCTGCTGG - Intronic
1117504690 14:56390399-56390421 GCATGTGACCTGCAGGCTGCGGG - Intergenic
1119484949 14:74981088-74981110 ACAGGAGACCAGCAGGCAGCAGG - Intergenic
1122322824 14:100865952-100865974 TCACGTGCCCACCAGCCAGCAGG + Intergenic
1123725371 15:23096148-23096170 GCACTTGCCCAGCCAGCAGCAGG - Intergenic
1128214189 15:65922932-65922954 GCACGTGTCCACCTGGCCGCTGG - Exonic
1128656751 15:69468285-69468307 GCAGGTCTCCAGCATGCAGCAGG - Intergenic
1128987230 15:72230523-72230545 GGACGTGACCAGCAAGCAGGGGG + Intronic
1129365570 15:75051904-75051926 GCACCTGACCAGCGGGGTGCAGG - Intronic
1130977426 15:88788265-88788287 GGACATGAACAGGAGGCAGCTGG - Intergenic
1131574993 15:93579943-93579965 GCATGTGGCCTGCAGGCTGCAGG - Intergenic
1132038186 15:98503666-98503688 GAGCCTGGCCAGCAGGCAGCTGG + Intronic
1132621502 16:870185-870207 GCCCCTGACCAGGAGGCAGGTGG - Intronic
1132706052 16:1243963-1243985 GGACGTGACAGGCAGGCTGCTGG + Intergenic
1134219161 16:12339876-12339898 GCACGTGGCCAACAGTCAGTGGG + Intronic
1135977456 16:27118277-27118299 GCATGTGGCCTGCAGGCTGCAGG - Intergenic
1137445363 16:48528312-48528334 GTGAGTGACCAGCAGGGAGCTGG - Intergenic
1137534029 16:49303937-49303959 GGAGGTATCCAGCAGGCAGCTGG - Intergenic
1138535748 16:57659463-57659485 GCTCGTGTCCAGCAGGAAGACGG - Exonic
1139527222 16:67524522-67524544 GGAAGTGTCCAGAAGGCAGCTGG - Intronic
1140573939 16:76141256-76141278 GCAAGTGACCAGAAGCAAGCAGG + Intergenic
1141017303 16:80462704-80462726 GCATGTGAACAGCAGTCATCTGG - Intergenic
1141028956 16:80571409-80571431 GGACATGTCCAGGAGGCAGCTGG - Intergenic
1141131890 16:81443205-81443227 GCCTGTGACCAGCATACAGCAGG + Intergenic
1141463909 16:84194717-84194739 GGACGTCACCTGCAGGGAGCTGG + Intronic
1141857608 16:86694526-86694548 GCAGGGGAGCAGCAGGCAGGAGG + Intergenic
1142347816 16:89565316-89565338 GTAGGGGAGCAGCAGGCAGCAGG - Exonic
1142901769 17:3016650-3016672 GCACGTGAGCAGCCTGCAGCAGG + Intronic
1142904566 17:3033471-3033493 GCACGTGGCCATGGGGCAGCAGG - Exonic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1147911463 17:43858544-43858566 GCACAGGGCCAGCAGGCAGAGGG + Intronic
1150138137 17:62706989-62707011 GCAAGTGGCCGGCAGGAAGCTGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151544494 17:74784459-74784481 GTAGGTGACTAGCAGGCAGCTGG + Intronic
1152237608 17:79146746-79146768 CCACGTGACCAGCAGGCTGCAGG - Intronic
1152526448 17:80890684-80890706 GCAGGTGAAGAGCCGGCAGCTGG + Intronic
1152819576 17:82429924-82429946 GGAAGCGACCAGCAGGCAGCTGG - Intronic
1155178560 18:23323402-23323424 GCAGGTGAAAAGCAGGCAACAGG - Intronic
1156812899 18:41274038-41274060 GCGGGAAACCAGCAGGCAGCAGG + Intergenic
1160063166 18:75550449-75550471 GTAGGTAACCAGCAGGCAGATGG + Intergenic
1160553727 18:79712858-79712880 ACATGTAACCAGCAGACAGCAGG - Intronic
1160653597 19:247383-247405 GCACGCCACCTGCAGGCAGATGG + Intergenic
1161752168 19:6105937-6105959 GGATGTACCCAGCAGGCAGCTGG + Intronic
1161924551 19:7291291-7291313 GCTTGAGGCCAGCAGGCAGCAGG - Intronic
1162495623 19:11021819-11021841 GCCCGTCAGCAGCAGGCGGCGGG - Exonic
1163666158 19:18605027-18605049 GCACCTGACCAGCAGGCGGGTGG - Intronic
1166625313 19:44346668-44346690 GCAGCTTTCCAGCAGGCAGCAGG - Intronic
925016376 2:527787-527809 GCAATTGACCGGGAGGCAGCTGG + Intergenic
925032424 2:661157-661179 GCAGGTGCACAGCAGGTAGCAGG - Intergenic
925333644 2:3077510-3077532 GCACATGGTCACCAGGCAGCAGG + Intergenic
925379887 2:3417339-3417361 GGAGGAGAGCAGCAGGCAGCGGG - Intronic
925438469 2:3862981-3863003 GCAGGTGAGCAGCAGGCAAGTGG + Intergenic
926210164 2:10863335-10863357 GCAGGTGTCCAGCAGGTGGCTGG + Intergenic
926316831 2:11716061-11716083 GCAGGTGACCAGCTGGCAGTTGG + Intronic
929933387 2:46276046-46276068 GCTCGTGCCCAGCAGCCAGTAGG + Intergenic
931667365 2:64618933-64618955 GCACGTGGCCTGCAGGCCACAGG - Intergenic
932152833 2:69388227-69388249 ACACATGAACAGCAGTCAGCAGG - Intergenic
934049358 2:88197621-88197643 GGAGGTGAACAGCAGGCAGAGGG - Intergenic
935229946 2:101087151-101087173 GCACGCAACCAGCAGGCCACAGG + Intronic
937790707 2:125957993-125958015 GCAAGTGACCGGGAGGCAGCAGG - Intergenic
939141764 2:138362426-138362448 GCAAGTGTCCAGCAGGCAACTGG + Intergenic
939378352 2:141400109-141400131 GCATGCGCCCAGCATGCAGCTGG - Intronic
941758159 2:169211128-169211150 GAACATGACCATCAGGCAGGAGG + Intronic
943551450 2:189345309-189345331 GCAGCTTTCCAGCAGGCAGCTGG + Intergenic
1171426196 20:25050298-25050320 GGAGGTGACAGGCAGGCAGCGGG - Intronic
1172036969 20:32018040-32018062 CCAGGTGAGCAGCAGGCAGCGGG - Exonic
1172463025 20:35134524-35134546 GCACGTTTCTGGCAGGCAGCAGG - Intronic
1172488954 20:35318725-35318747 ACACGTGATCTGCAGGCAACAGG + Intronic
1172860437 20:38045909-38045931 GCACGTGGCCTGCAGGCAATGGG - Intronic
1174451633 20:50624335-50624357 GCAGGTGGGCAGCAGGCAGTGGG + Intronic
1175221614 20:57420649-57420671 TCACGTGAGCAGCAGGGTGCTGG + Intergenic
1176185207 20:63774646-63774668 GCGCGAGACCAGAAGGCAGCTGG + Intronic
1176189821 20:63803115-63803137 GCACCTCACCAGCAGGAACCAGG + Intronic
1176201771 20:63864149-63864171 GCGCGTAACCACCAGGCAACTGG - Intergenic
1176278039 20:64285646-64285668 GCACGCCACCTGCAGGCAGATGG - Intronic
1177807690 21:25890168-25890190 CCAAGAGAACAGCAGGCAGCAGG - Intronic
1179264242 21:39788591-39788613 TCACGTGACTTGCAGGCATCCGG - Intronic
1179897374 21:44370196-44370218 GGGCGTGGCCAGCAGGCAGCTGG + Intronic
1180614698 22:17119928-17119950 GCACGTGCCCAGGAAGCATCCGG + Exonic
1180786872 22:18552495-18552517 CCATGTGAGCAGCAGCCAGCGGG + Intergenic
1181243783 22:21492016-21492038 CCATGTGAGCAGCAGCCAGCGGG + Intergenic
1181395672 22:22619475-22619497 GCATGTGGCCTGCAGGCTGCAGG + Intergenic
1182105742 22:27687845-27687867 GCACGCGACCTGCAGGCACCAGG + Intergenic
1182376939 22:29855554-29855576 GCCCCTGATCAGCAGGCAGGAGG - Intergenic
1182411377 22:30189821-30189843 GCACAGGAACAGCAGGCAGCAGG - Intergenic
1184129985 22:42512005-42512027 GCTCCTGACCTGCAGGGAGCTGG + Exonic
1184140163 22:42573823-42573845 GCTCCTGACCTGCAGGGAGCTGG + Intronic
1184249625 22:43252784-43252806 GCACCTGACCAGCATGGGGCAGG + Intronic
1184433019 22:44452700-44452722 GCAAGTGTGCAGCAGGCACCAGG - Intergenic
1185222953 22:49638115-49638137 GCAGCTGCCCAGCAGGCAGCGGG - Intronic
950236092 3:11321419-11321441 GACCGTGACCAGCATGCAGCTGG + Intronic
950445515 3:13035208-13035230 TCAGGGGACCAGCAGGAAGCTGG - Intronic
954363638 3:50135060-50135082 TCATGTGAGCAGCAGGCATCTGG + Intergenic
955581483 3:60427765-60427787 GGAATTGACCAGCAGGCAGTAGG - Intronic
960811945 3:121634311-121634333 GCAGGTGGCCAGGAGGCAACAGG - Exonic
960836244 3:121909725-121909747 GCATGTGGCCTGCAGGCTGCAGG - Intronic
961369322 3:126419890-126419912 GCAGGTTACCTGCAGGCATCTGG + Intronic
961511863 3:127408354-127408376 GGAGCTGCCCAGCAGGCAGCTGG + Intergenic
961855461 3:129865921-129865943 GCAGATGTCCAGCAGGCAGTAGG + Intronic
962315252 3:134355243-134355265 GCATGTGGCCAGCAGTTAGCTGG - Intergenic
962742479 3:138371991-138372013 TAAGGTGACCAGGAGGCAGCTGG - Intronic
968511878 4:999386-999408 ACACATGACAATCAGGCAGCAGG - Intronic
969234019 4:5852555-5852577 GCACATGCCCAGCATACAGCAGG - Intronic
969513309 4:7631934-7631956 GCACCTGCCCAGAAGGCAGCTGG - Intronic
970056288 4:11976926-11976948 GCACTGAACCAGCAGCCAGCAGG + Intergenic
970671236 4:18398824-18398846 GCATGTGTCCAGGAGGGAGCTGG - Intergenic
970911050 4:21276041-21276063 ACATGTGGCCTGCAGGCAGCAGG + Intronic
976202246 4:82591011-82591033 GTTCTTGACCAGCAGGCAGTAGG + Intergenic
977440619 4:97062517-97062539 GCACAAGACCAGGAGGCATCAGG - Intergenic
979378045 4:119972206-119972228 GCACGTGGCCTGCAGGCCGTGGG + Intergenic
986269275 5:6217295-6217317 ACAGGGGAGCAGCAGGCAGCAGG - Intergenic
988092697 5:26563309-26563331 CCACGTGACCAGCAGGAACAAGG + Intergenic
990347301 5:54883580-54883602 GCACGTGACCCGCAGGGCTCGGG - Intergenic
999177333 5:149640565-149640587 GCAGGTGTCCATCAGGCAGTTGG + Intergenic
999383605 5:151139148-151139170 GCACGAGCCCAGCATACAGCAGG + Intronic
1001314510 5:170632892-170632914 GCACGCACCCAGCAGGCAGCAGG + Intronic
1002517933 5:179773482-179773504 GCGCCTGGCCAGCAGGCTGCAGG - Intronic
1002754856 6:148895-148917 GCACGCCACCTGCAGGCAGATGG + Intergenic
1003329108 6:5114830-5114852 GCACGTGGCCCGCAGGCTGTGGG + Intronic
1004294240 6:14395551-14395573 GCACGGGAACAGCAGGCAGCTGG + Intergenic
1005718978 6:28582162-28582184 GCAAGTGGCCTGCAGGCTGCAGG - Intronic
1006507040 6:34496034-34496056 ACAGGGGAGCAGCAGGCAGCTGG - Intronic
1011129468 6:84038364-84038386 GCAGGAGACCAGCATGCAGCAGG + Intronic
1015681621 6:135814817-135814839 GCATGTGGCCTGCAGGCTGCAGG - Intergenic
1016547720 6:145243123-145243145 ACACCTGACCAACAGGGAGCAGG + Intergenic
1017696297 6:157019794-157019816 GGAGGTGACCCGCTGGCAGCAGG - Intronic
1019080556 6:169426844-169426866 GCAGGCAAGCAGCAGGCAGCAGG - Intergenic
1019365461 7:630387-630409 GCAGGTGGCAGGCAGGCAGCGGG + Intronic
1019368947 7:650796-650818 TCACGTGGCCAGCAGGCAGCAGG + Intronic
1022239866 7:28500251-28500273 GCAAGTGGCCAGCAGGAAGCGGG + Intronic
1022606928 7:31824632-31824654 AATCGTGACCAGCAGGCACCTGG - Intronic
1023898535 7:44455197-44455219 GCAAGTGACCAGCAGACAGTTGG - Intronic
1023935669 7:44738117-44738139 GCCCATGACCAGCAGGCCCCTGG - Intergenic
1024093748 7:45968249-45968271 TCAGGTGAGCAGCAGGCACCAGG - Intergenic
1024472175 7:49775473-49775495 GCAGGTGACCAGGAGGGAACTGG - Exonic
1026904439 7:74054884-74054906 GCAAGTCACCAGCAGGCCTCAGG + Intronic
1027916765 7:84334641-84334663 GGGGGTGACCAGGAGGCAGCAGG - Intronic
1030043163 7:105469954-105469976 GCATGTGGCCCGCAGGCTGCAGG + Intronic
1033422045 7:141212234-141212256 CCCCGGGACCAGCAGACAGCAGG - Intronic
1033655121 7:143368088-143368110 GGACCTGACCAGGAAGCAGCAGG - Intergenic
1035185574 7:157123310-157123332 GCAAGTGTCCAGGGGGCAGCAGG - Intergenic
1038893671 8:31756325-31756347 CCAGGTGACTAGCAGGAAGCAGG + Intronic
1039333905 8:36569036-36569058 GCACAGGATCAGCAGGAAGCAGG - Intergenic
1039449583 8:37661290-37661312 GCAGGTGACAAACAGGCAGTTGG + Intergenic
1041021603 8:53643749-53643771 GCACGAGGCCAGCCGTCAGCAGG + Intergenic
1041738333 8:61134069-61134091 GGAGATGTCCAGCAGGCAGCTGG + Intronic
1044698123 8:94943085-94943107 GGAGATGTCCAGCAGGCAGCAGG + Intronic
1045276559 8:100711351-100711373 GCATGTGGCCTGCAAGCAGCGGG + Intronic
1045314810 8:101034323-101034345 GCAGGTGAACAGCAGGAACCTGG + Intergenic
1046680371 8:117162982-117163004 GCATGTGGCCAGCATACAGCTGG - Intronic
1048179567 8:132182575-132182597 GCACCTGTCCAGCAGGGATCTGG + Intronic
1049172571 8:141170851-141170873 GCTCGTGACCGGGAGACAGCAGG - Intronic
1049300427 8:141866760-141866782 GCAGGTGAGCAGCAGGCTGGAGG + Intergenic
1049588291 8:143441824-143441846 GCACGAGGCAGGCAGGCAGCTGG - Intronic
1049671730 8:143873040-143873062 GCCCGAGCCCAGCAGGCAGGAGG + Exonic
1049726272 8:144147965-144147987 GCGGGTGGCCAGAAGGCAGCGGG + Intergenic
1051349393 9:16184904-16184926 GCCAGTGACCAGCAGCCAGCAGG + Intergenic
1052751148 9:32492256-32492278 ACGCGAGACCAGCAGGAAGCTGG - Intronic
1055673784 9:78634352-78634374 GCAGGTCTTCAGCAGGCAGCAGG - Intergenic
1057298560 9:93863303-93863325 GGAAGTGAGGAGCAGGCAGCAGG + Intergenic
1058773673 9:108263829-108263851 GTACCTGTCCAGAAGGCAGCTGG - Intergenic
1060881865 9:127123034-127123056 GCGTGCGAGCAGCAGGCAGCGGG + Intronic
1062490845 9:136804236-136804258 GGACCTGGCCAGGAGGCAGCTGG + Intronic
1062497598 9:136838993-136839015 GGACGGGGCCTGCAGGCAGCGGG - Exonic
1062502226 9:136856494-136856516 GGCCCTGACCAGCAGGGAGCTGG + Intronic
1185793471 X:2945250-2945272 CCACGTGGCCAGAATGCAGCAGG + Intronic
1189268875 X:39736470-39736492 GGAGGTGACCAGCAGGCAGAAGG + Intergenic
1190336855 X:49267815-49267837 GCAGGGGACCAGCAAGGAGCTGG + Intergenic
1190393294 X:49954256-49954278 GCACGTGACCCACAGGCCGCGGG - Intronic
1191716225 X:64195501-64195523 GGAAGTGACCGGCAGGCAGGAGG + Intronic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1200093127 X:153644935-153644957 GGCTGTGACCAGCAGGGAGCTGG - Intronic
1200146432 X:153928539-153928561 GCACGTGACCAGCAGGCAGCCGG - Intronic
1200219064 X:154381797-154381819 GCACGCTACCAGCAGTCTGCGGG + Intergenic