ID: 1200150186

View in Genome Browser
Species Human (GRCh38)
Location X:153947464-153947486
Sequence GGCTCACGGGAGCCCCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200150186_1200150194 6 Left 1200150186 X:153947464-153947486 CCTCCAGGGGGCTCCCGTGAGCC 0: 1
1: 0
2: 3
3: 67
4: 246
Right 1200150194 X:153947493-153947515 AGGTCTCAGCCTTCCCGCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 128
1200150186_1200150196 18 Left 1200150186 X:153947464-153947486 CCTCCAGGGGGCTCCCGTGAGCC 0: 1
1: 0
2: 3
3: 67
4: 246
Right 1200150196 X:153947505-153947527 TCCCGCTCAGGCTTCCTGAGAGG 0: 1
1: 0
2: 2
3: 13
4: 158
1200150186_1200150199 25 Left 1200150186 X:153947464-153947486 CCTCCAGGGGGCTCCCGTGAGCC 0: 1
1: 0
2: 3
3: 67
4: 246
Right 1200150199 X:153947512-153947534 CAGGCTTCCTGAGAGGATGCCGG 0: 1
1: 0
2: 1
3: 32
4: 277
1200150186_1200150200 26 Left 1200150186 X:153947464-153947486 CCTCCAGGGGGCTCCCGTGAGCC 0: 1
1: 0
2: 3
3: 67
4: 246
Right 1200150200 X:153947513-153947535 AGGCTTCCTGAGAGGATGCCGGG 0: 1
1: 0
2: 3
3: 32
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200150186 Original CRISPR GGCTCACGGGAGCCCCCTGG AGG (reversed) Intergenic
900296676 1:1955381-1955403 GGCTCTGCGGTGCCCCCTGGAGG - Intronic
900913827 1:5620594-5620616 TGCACATGGTAGCCCCCTGGTGG + Intergenic
903220440 1:21866202-21866224 GGCTGACGGCAGCCCCTCGGAGG + Intronic
903238156 1:21964145-21964167 GGCTCTCGGGCGCCCCTTGCTGG + Intergenic
903832526 1:26183584-26183606 GGCCCATGGAAGCCCCCAGGAGG + Intronic
904478548 1:30779756-30779778 GGGTCAAGGGCGCCCCCTGCTGG + Intergenic
904577140 1:31512193-31512215 GGCTCACGTGATCCTCCTGTTGG - Intergenic
906323634 1:44831210-44831232 AGCTCACTGTAGCACCCTGGTGG - Intronic
906687130 1:47770013-47770035 TGCTCCAGGGAGCCCCTTGGAGG - Intronic
914902994 1:151721748-151721770 GGCGCAGGGGAGACCCCCGGCGG + Intronic
915367300 1:155323445-155323467 GGCCGACGGGCGCCCCCTGTTGG + Intronic
919780386 1:201217216-201217238 GGCTCATGGGGAGCCCCTGGGGG - Intronic
920350677 1:205335974-205335996 GGGTCCAGGGAGCCTCCTGGAGG - Intergenic
923744413 1:236686844-236686866 CGCGCACGGGAGCCCCGCGGGGG - Intronic
924465975 1:244299621-244299643 GGCACACTGGTGCCACCTGGAGG + Intergenic
924563140 1:245173670-245173692 GGCTCACTGCAGTCCCTTGGAGG + Intronic
1063149435 10:3323023-3323045 GGCTCACAGGGGCTCCCGGGAGG - Intergenic
1063504078 10:6580365-6580387 GGCTGGCGAGCGCCCCCTGGCGG - Intergenic
1065123534 10:22550939-22550961 GGCTCACTGGCGCCCCCCGGTGG - Intronic
1067091038 10:43266042-43266064 GCCTCTTGGGAGCCACCTGGGGG - Intronic
1067201115 10:44172846-44172868 GGCTGGCGGGAGGCCCCTGCTGG - Intergenic
1067694430 10:48524462-48524484 GGCTCCGTGGCGCCCCCTGGCGG - Intronic
1070743298 10:78916628-78916650 GCTTCACAGGAGCCTCCTGGAGG - Intergenic
1072319245 10:94232851-94232873 GGCTAGCTGGAGCTCCCTGGTGG - Intronic
1072809226 10:98446565-98446587 GGCAAACGGGAGCCCCGCGGCGG - Intronic
1073454433 10:103628107-103628129 GGCTCTCGGGTGCCTCCAGGTGG + Intronic
1075023718 10:118968727-118968749 GGCTCACTGCAGCCATCTGGAGG - Intergenic
1075576605 10:123582308-123582330 GGCTCACGGGCTCCCCCGAGTGG - Intergenic
1076192997 10:128495954-128495976 GGCTCTTGGGACCCGCCTGGGGG + Intergenic
1076324644 10:129611724-129611746 GGCTCCCGGGTGCGCTCTGGGGG + Intronic
1076825029 10:132962631-132962653 GGGGCAGGGGAGCCCCCAGGTGG - Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077134555 11:991975-991997 CTCTCACGGGTGCCCCCCGGAGG - Intronic
1078853904 11:15190778-15190800 GGCACAAGGGAGCCCCCTCCTGG - Exonic
1078915043 11:15771001-15771023 GACTCACTGGTGCTCCCTGGTGG - Intergenic
1080918884 11:36688760-36688782 GGGTAAAGGGAGCCCCCAGGTGG + Intergenic
1081720710 11:45286270-45286292 GGATCCCGGGAGCTGCCTGGAGG - Exonic
1082063746 11:47882146-47882168 GGCTCAAGGGATCCTCCTGCAGG - Intergenic
1082807218 11:57458847-57458869 GGCTCTCGGGTGCCCCCTGCTGG - Intergenic
1083642542 11:64153230-64153252 AGCTCACGGGCTCCCCCTGCTGG + Intronic
1083902411 11:65650058-65650080 GGCTTACCGCAGCACCCTGGTGG - Intronic
1083941638 11:65899496-65899518 GCCTCCCGGGTGCCCCCCGGCGG + Intronic
1084322470 11:68381323-68381345 GTGTCACGGGAGCCCTCTGCAGG + Intronic
1084432991 11:69121897-69121919 GACTCTGGGGAGGCCCCTGGTGG + Intergenic
1084516827 11:69642074-69642096 GGCTGCCGGGAGCCCGCGGGAGG + Intronic
1084671512 11:70609308-70609330 GGGTCACAGGAGGCCCCAGGAGG + Intronic
1084733317 11:71088692-71088714 GGATGAGGGGAGGCCCCTGGTGG - Intronic
1084733392 11:71088962-71088984 GGATGAGGGGAGGCCCCTGGTGG - Intronic
1089303327 11:117511765-117511787 GCCTTACGGGAGGGCCCTGGTGG + Intronic
1089462132 11:118659594-118659616 GGCTCACAGCTGCCCCCCGGTGG + Intronic
1089466665 11:118690233-118690255 GGCTCACAGCTGCCCCCCGGTGG + Intergenic
1089590013 11:119534003-119534025 GGCTCTCGGGCTCCCCCTGGAGG + Intergenic
1090796262 11:130138096-130138118 GTGTCACGGGATCCCCCAGGTGG + Intronic
1091124566 11:133082980-133083002 CGCTGACGGGCGCCCTCTGGCGG - Intronic
1092290578 12:7157608-7157630 GGGTCACTGGAGGCCCCTGGAGG - Exonic
1094818715 12:34209052-34209074 GGCTCACGAGAGCACCCTGTGGG + Intergenic
1096121573 12:49092320-49092342 GGATCTGGGGAGCCCCCTGCAGG + Intronic
1096605156 12:52759909-52759931 GGTCAACCGGAGCCCCCTGGAGG + Intergenic
1098161227 12:67649293-67649315 GGCGCGGGGGAGCCCCCGGGCGG + Intronic
1101983559 12:109428204-109428226 TGCCCACGGCTGCCCCCTGGTGG - Intronic
1102406238 12:112676604-112676626 GGCTCCCAGGAGCTCTCTGGAGG + Intronic
1103059899 12:117850147-117850169 GGCTCACTGGTTCCCCCTGGTGG + Intronic
1103346888 12:120257116-120257138 AGCTCCCTGGAGCTCCCTGGAGG + Intronic
1103565269 12:121812135-121812157 GGCCCGCGGGCGCCCCCTGCTGG + Intronic
1104805436 12:131586540-131586562 GCCTCAGGGGAGCACACTGGGGG + Intergenic
1105439466 13:20403232-20403254 GTGTCAGGGGAGCCCACTGGTGG + Intergenic
1108095250 13:46894236-46894258 GGAGCAAGGGCGCCCCCTGGCGG - Intronic
1111880436 13:93949812-93949834 GGATCACGGGAGCCCAGAGGTGG - Intronic
1113782550 13:112985061-112985083 GGCACAAGGGACCCCGCTGGGGG - Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114269599 14:21092636-21092658 GGCTCCCGAGCGTCCCCTGGCGG - Exonic
1116996608 14:51331470-51331492 GGCTCACTGGACACCCTTGGAGG + Intergenic
1118191072 14:63580877-63580899 GGCTCACTGAAGCCCTCTGATGG - Intergenic
1119035984 14:71231072-71231094 TGCCCCTGGGAGCCCCCTGGAGG + Intergenic
1119665861 14:76484555-76484577 GGCTCACGAGTGGCGCCTGGTGG + Intronic
1119886882 14:78150941-78150963 GGAACACTGGAGACCCCTGGGGG - Intergenic
1122623773 14:103073993-103074015 GGCTCAGGGGATTCCCTTGGAGG + Intergenic
1123144600 14:106116552-106116574 GTGTCCCGGGCGCCCCCTGGTGG + Intergenic
1123148055 14:106153539-106153561 GGGTCACGAGCGCCCCCTGGTGG + Intergenic
1123156806 14:106234979-106235001 GTGTCCCGGGCGCCCCCTGGTGG + Intergenic
1123207577 14:106728080-106728102 GTGTCCCGGGCGCCCCCTGGTGG + Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202854754 14_GL000225v1_random:43407-43429 GCCTCACGAAAGCCCCCTGTGGG - Intergenic
1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202860687 14_GL000225v1_random:79433-79455 GGCCCACGAAAGCCCCCTGAGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1123491489 15:20785312-20785334 TGCTGCCGGGAGCCACCTGGCGG - Intergenic
1123547991 15:21354403-21354425 TGCTGCCGGGAGCCACCTGGCGG - Intergenic
1124258309 15:28163992-28164014 GGCACACAGAAGCCTCCTGGAGG + Intronic
1126140105 15:45430454-45430476 GACTCCCGGGCGCCCCCTGCAGG - Intergenic
1128940613 15:71784902-71784924 GGCTCACTGCCTCCCCCTGGTGG - Intergenic
1130022391 15:80242322-80242344 GGCTCACAGGAGCCCCCTTGCGG - Intergenic
1130151325 15:81313773-81313795 GGGTCCCAGGAGCCCCCAGGAGG - Intronic
1131177582 15:90219725-90219747 GGCTCGGCGGTGCCCCCTGGTGG + Intronic
1202956321 15_KI270727v1_random:81633-81655 TGCTGCCGGGAGCCACCTGGCGG - Intergenic
1136417510 16:30112908-30112930 GGGTGACTGGCGCCCCCTGGAGG - Intronic
1136518499 16:30782035-30782057 GCATCTCAGGAGCCCCCTGGGGG - Exonic
1136910679 16:34141882-34141904 GGCTCACGAAAGCCCCATGTGGG + Intergenic
1136910767 16:34142520-34142542 GGCTCACGAAAGCCCCATGTGGG - Intergenic
1139588530 16:67919835-67919857 GGCTCTGGGGAGCCCAGTGGTGG - Intronic
1141388823 16:83647378-83647400 TGCTCACGGGTGACCCCAGGAGG + Intronic
1141805833 16:86340890-86340912 GGCTCCCCTGCGCCCCCTGGTGG - Intergenic
1142034300 16:87854151-87854173 GGCTGACGGGTGCCACCGGGAGG + Intronic
1142287290 16:89176625-89176647 GGCTCACGGGACTCCCCAGCCGG - Intronic
1142412210 16:89922677-89922699 CGCTCATGGCAGCCCCTTGGTGG + Intronic
1143033669 17:3982312-3982334 GGCTCACGAGAGGCCTGTGGTGG + Intergenic
1143830358 17:9645842-9645864 GGCCCCCGGGAGCCCCGGGGAGG + Exonic
1145094000 17:20009296-20009318 GGCTCGCGCTCGCCCCCTGGCGG + Intergenic
1146313916 17:31792453-31792475 GAGTTACGGGAGCCCCCAGGAGG - Intergenic
1146395498 17:32461908-32461930 TCCTCATTGGAGCCCCCTGGTGG - Intronic
1146395550 17:32462504-32462526 TCCTCACTGGAGCCCCCTGGTGG - Intronic
1147168822 17:38606502-38606524 GGCTCCCCGGCGCCCCCTGCTGG + Intergenic
1147575664 17:41597808-41597830 GCCACATGGGAGCCCCATGGGGG + Intergenic
1147893382 17:43733420-43733442 GGCTCAATTGAGCCTCCTGGTGG + Intergenic
1148462665 17:47847345-47847367 GGCGCAGTGGAGCCCCCCGGGGG - Exonic
1148768339 17:50052529-50052551 GGGTCATGGAAGCTCCCTGGAGG - Intergenic
1150108766 17:62479568-62479590 GGCTCTCGGGGGCGCCCGGGAGG - Intronic
1151702311 17:75750042-75750064 GGGTCTCTGGCGCCCCCTGGTGG + Intronic
1151767557 17:76140167-76140189 GGCGCCCGGGTCCCCCCTGGCGG - Exonic
1152209208 17:78994183-78994205 GGCTCATCGGAGCCTCCTCGGGG + Intronic
1152304085 17:79511144-79511166 GGCTCACGGGAGCCTCCACCTGG + Intronic
1152781557 17:82229274-82229296 GGCTCTCGGGAGCCCTCGGTGGG - Intronic
1158077539 18:53548182-53548204 TTCTCATGGGAGCCCCCAGGTGG - Intergenic
1158625804 18:59070602-59070624 GTTCCTCGGGAGCCCCCTGGTGG + Intergenic
1160527251 18:79544924-79544946 CCCTCACGGGGGCCCCCCGGTGG + Intergenic
1160871503 19:1279880-1279902 GGCTCAAGGCTGCCACCTGGTGG - Intergenic
1160904306 19:1445338-1445360 GGCTCGCGGGCGCCCGCTGGCGG - Intergenic
1161226116 19:3146764-3146786 TGCTCACAGGCGCCCTCTGGTGG - Intronic
1161258857 19:3324577-3324599 TGCTCACAGGCGCCCTCTGGTGG - Intergenic
1161289447 19:3485167-3485189 TGCTCACAGGTGCCCCCTGGTGG + Intergenic
1161331945 19:3692683-3692705 AGCTCACAGGCACCCCCTGGTGG - Intronic
1161484059 19:4525288-4525310 GGCTCACAGGTGCCCTCTGGTGG + Intronic
1161534694 19:4811854-4811876 TGCTCACAGGTGCCCTCTGGTGG - Intergenic
1162133784 19:8543391-8543413 GGCTCACAGGAGGGGCCTGGGGG + Intronic
1162788662 19:13051863-13051885 GGCTCCCGGGAGCAGCCGGGCGG + Intronic
1162819329 19:13213021-13213043 TGCTCATGGGCGCCCTCTGGTGG - Intronic
1162821220 19:13224813-13224835 GGCTCACGGGAGACCCAGGAGGG - Intronic
1163752741 19:19087852-19087874 GGCTCAAGTGAGCCCACAGGAGG + Intronic
1163847982 19:19647845-19647867 TCCTCACGGGAGCCAGCTGGGGG - Intronic
1165074979 19:33275668-33275690 GGTTCTCGGGGGCCCCCTTGGGG - Intergenic
1165129195 19:33621790-33621812 GGCGCCCGCGAGCCCCCGGGAGG + Intergenic
1166218755 19:41352632-41352654 GGCACTCCGGCGCCCCCTGGGGG + Intronic
1166984942 19:46654144-46654166 GACTCACTGGAGCTTCCTGGTGG - Intronic
1167098828 19:47391602-47391624 GGCTCTCCAGCGCCCCCTGGAGG + Intergenic
1167144466 19:47673476-47673498 CCTTCAGGGGAGCCCCCTGGAGG - Intronic
1167266519 19:48485565-48485587 GGGTCAGGGGAGCCATCTGGGGG + Exonic
1168249886 19:55135874-55135896 GGCTCCTGGAAGCCCTCTGGGGG - Intronic
1168255071 19:55160701-55160723 GGCTCTCGCGCGCCCCCAGGCGG + Exonic
1168282108 19:55311462-55311484 GGCTCAAGGGAGCCTACTGGTGG - Intronic
925284833 2:2709131-2709153 CCCTCACGGAAGCCCCGTGGAGG + Intergenic
925480869 2:4272658-4272680 GCCTGACGGGATCCCCCTTGTGG + Intergenic
925890553 2:8430821-8430843 TGCTCACTGGGACCCCCTGGAGG - Intergenic
927497981 2:23563430-23563452 GCCTCCCAGGAGCCCCCTTGGGG + Intronic
928125892 2:28615593-28615615 GGCTCACGTTAGCCCAGTGGAGG + Intronic
928264599 2:29800933-29800955 CGCCCACGGGAGCCCACAGGAGG - Intronic
930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG + Intronic
931321562 2:61178036-61178058 GGCTCGCGGGAGGCGCCTGCGGG - Exonic
934716987 2:96550140-96550162 GGCCGGCGGGCGCCCCCTGGCGG - Intronic
934731504 2:96661482-96661504 GGCCCAGGGGTGCCCCCAGGAGG - Intergenic
936987230 2:118323170-118323192 GGGTCAGGGAAGCCTCCTGGAGG - Intergenic
937084061 2:119158941-119158963 GGCTCCTGGGAGCCGCCAGGGGG - Intergenic
937383330 2:121402481-121402503 GTCTCACAGGAGACCCCTGGTGG - Intronic
937924495 2:127157537-127157559 AGCCCACGGGTGCTCCCTGGAGG + Intergenic
939930993 2:148232568-148232590 GGCTCAAGTGATCCTCCTGGTGG + Intronic
944511456 2:200470104-200470126 ACCTCACGTTAGCCCCCTGGGGG - Intronic
948677068 2:239602949-239602971 GGCTCACAGGTCCCCTCTGGAGG - Intergenic
948981257 2:241496079-241496101 AGCTCCCGGGAGCCACCAGGTGG + Intronic
948988179 2:241538813-241538835 GGCCCAGGTGAGCCTCCTGGAGG + Intergenic
1168878380 20:1185916-1185938 GGCTCAAGGGCGCCACCTGAAGG + Intronic
1169254278 20:4085411-4085433 GGCTCACAGCTGCCCCCTGGTGG + Intergenic
1171770389 20:29318928-29318950 CGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172284578 20:33731917-33731939 GGCTCCTGGGCGCCCCCTGGCGG + Exonic
1172873094 20:38147904-38147926 GGCCTGCGGGAGCCCCCTGTAGG + Intronic
1173663592 20:44750637-44750659 GGCTCTCGGGCGCCCCCGGGGGG - Exonic
1173808048 20:45939011-45939033 GAATCACGGCAGCCCCCGGGAGG + Exonic
1174611164 20:51800327-51800349 TGCGCGCGGGCGCCCCCTGGAGG - Intronic
1175435537 20:58944946-58944968 CCCTCACGGGAGCCACATGGAGG - Intergenic
1175889639 20:62310512-62310534 GCTGCACGGGAGGCCCCTGGGGG - Exonic
1176073949 20:63240094-63240116 GGCTCTGGGGAGCCCCGAGGCGG - Intronic
1178379591 21:32096672-32096694 AGCAGAGGGGAGCCCCCTGGAGG - Intergenic
1178397293 21:32253583-32253605 GGCTGATGGGAGCCCCAGGGAGG + Intergenic
1179607999 21:42530705-42530727 GCCTCACTGAATCCCCCTGGAGG - Intronic
1179955459 21:44735770-44735792 GGGTCACGGGTGCTCCCTGCAGG + Intergenic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1181638871 22:24186636-24186658 GGATCCCGGGAGCCTTCTGGAGG + Intronic
1181670550 22:24423872-24423894 CGCTCACGGGCGCCCCCTGCAGG - Intronic
1182445584 22:30387493-30387515 GGGCCGCGGGCGCCCCCTGGTGG + Intronic
1182583097 22:31327043-31327065 GGCTCTCGGGGGCCCCCTGGGGG - Exonic
1182790802 22:32951268-32951290 GGCTCAGGGAAGCCCTTTGGTGG - Intronic
1183304978 22:37077970-37077992 TGCTCAGGGGCGCCCCCTGGCGG - Intronic
1183379911 22:37485634-37485656 GGCTCCCGGGTCCCTCCTGGGGG - Intronic
1184004290 22:41697274-41697296 GGTTCTCTGGCGCCCCCTGGTGG - Exonic
1184155063 22:42662141-42662163 GGCTCGGGCGCGCCCCCTGGAGG - Intergenic
1184339304 22:43877277-43877299 GGCTCACAGGAGGCCCCCAGTGG + Intergenic
1184680577 22:46070670-46070692 GGCACACGGGAGCCGGCCGGCGG - Intronic
1184695583 22:46137190-46137212 GGCTCACGGGAGGCTCCTGGCGG - Intergenic
1184795585 22:46730781-46730803 GACACACGGCATCCCCCTGGGGG + Intronic
1185117047 22:48943977-48943999 GGCTCACGGGCCCCGCCTGCTGG - Intergenic
1185282967 22:49983542-49983564 GCCTCCGTGGAGCCCCCTGGCGG - Intergenic
950032045 3:9859877-9859899 GGCTCAGGGGAGTGTCCTGGTGG + Intergenic
950530080 3:13548300-13548322 GGCTGCAGGGAGACCCCTGGGGG + Intergenic
952512244 3:34069267-34069289 GGGTCATGGGAGGCCCCTGCTGG - Intergenic
953031890 3:39185065-39185087 GGCTCTCAGGGGCCCCTTGGTGG + Exonic
954386419 3:50246352-50246374 GGCTGCCGGGCGCCCCCTGGTGG + Intronic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
961330470 3:126135285-126135307 GGCTCAGGGGAGGTGCCTGGTGG - Intronic
961621287 3:128226983-128227005 GGGGCAGGGGGGCCCCCTGGTGG - Intronic
961734600 3:128993640-128993662 AGCTCCCGGGAGCCACCAGGCGG + Intronic
961748997 3:129084708-129084730 GGCTCCAGGGAGCTCCCTCGGGG + Intergenic
962808199 3:138941466-138941488 GGCTGCAAGGAGCCCCCTGGCGG - Intergenic
963062486 3:141235755-141235777 GGTTCACGGGTGCCTCCTCGTGG - Intronic
963071978 3:141311929-141311951 GGCTCACGAACGACCCCTGGAGG - Intergenic
967883254 3:194316129-194316151 AGCTCATGGGAGTCGCCTGGAGG + Intergenic
969345101 4:6564977-6564999 GGCTCCTGGGAGGACCCTGGAGG - Intergenic
969631709 4:8342890-8342912 GGCTCAGGAGGGCCCCCTGGAGG + Intergenic
969681241 4:8644610-8644632 GGCTCTGGGGAGGCTCCTGGTGG + Intergenic
969787975 4:9473842-9473864 GGCTCTTGGGAGCCCCATGTCGG + Intergenic
976245649 4:83003611-83003633 GGATCACTTGAGCCCCCAGGTGG - Intronic
977400118 4:96521411-96521433 GGCCCACGGGAGCCCACGGCGGG - Intergenic
980865964 4:138553433-138553455 GCCCCGCGGGAGCCCACTGGTGG - Intergenic
984702309 4:182826128-182826150 GGCTCACAGAAGGGCCCTGGGGG - Intergenic
984801793 4:183722936-183722958 GCCTCAGGGGAGCCTCCTCGCGG - Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985574835 5:669259-669281 GGCTCACCAGCGCCCCCTGGGGG - Intronic
985794271 5:1950309-1950331 GTGTCCCGGGAGCCCCCTGGGGG - Intergenic
988554062 5:32221320-32221342 GTCTCTCGGGAGTCCCCAGGGGG + Intergenic
989557424 5:42813744-42813766 GGCTGACTGGAGTCCCCTGCAGG - Intronic
997207175 5:132056780-132056802 GGCTCACGGAAGCGCTGTGGTGG + Intergenic
1001056329 5:168453135-168453157 GGATCACTTGAGCCCACTGGTGG + Intronic
1002082997 5:176748528-176748550 CCCTCACGGGACCCCCGTGGAGG + Intergenic
1002866274 6:1125068-1125090 GGTCCATGGGAGCCCCCGGGGGG - Intergenic
1006621855 6:35370861-35370883 AGCTCACACGAGCCCCATGGTGG + Intronic
1007107244 6:39292220-39292242 GGCTCACAGTAGTCTCCTGGTGG + Intergenic
1007938809 6:45757672-45757694 GGCTCAGGGAGGCCCACTGGAGG + Intergenic
1008572719 6:52830584-52830606 GGCTCACTGGGGCCCGGTGGAGG + Intergenic
1019374158 7:680303-680325 GGGTCACTGCAGCCCCATGGCGG - Intronic
1021109812 7:16680717-16680739 GGATCACTTGAGCACCCTGGAGG + Intronic
1021573941 7:22090712-22090734 GCCGCACGGGAGCCCACAGGGGG - Intergenic
1023867346 7:44244474-44244496 GGCCCCAGGGAGCCCCCTGCTGG - Intronic
1024992892 7:55250394-55250416 GACTCAGGACAGCCCCCTGGAGG - Intronic
1025177858 7:56811023-56811045 GCCTCACGGAGGCCCTCTGGAGG - Intergenic
1026959395 7:74398856-74398878 GGCTCTAGGGAAGCCCCTGGGGG - Intronic
1027151705 7:75738431-75738453 AGCGCACGGGAGCCACTTGGAGG - Intronic
1027423536 7:78040360-78040382 GGAGGACGGGCGCCCCCTGGCGG + Intronic
1028696140 7:93715417-93715439 GGTCCACAGGAGACCCCTGGCGG - Intronic
1029270596 7:99374811-99374833 GGGTCAGGGGAGCCACCTGGAGG + Intronic
1032037780 7:128532078-128532100 GGCTCTCGGGGGCGCCCGGGAGG - Intergenic
1032128335 7:129210655-129210677 GGTTCACCGCTGCCCCCTGGTGG + Intronic
1033598571 7:142873432-142873454 GGCCCAGGTGAGCCCCCTGGTGG - Exonic
1034468937 7:151245617-151245639 GGCCCATGGGCGCCCCCTGGTGG + Exonic
1034567892 7:151930043-151930065 GGGTCACGGGTGCCTCCTGGAGG + Intergenic
1036757623 8:11481693-11481715 GGCTCACGGGAGAGTACTGGGGG + Intergenic
1037759492 8:21732561-21732583 GTCTCATGGGGGCTCCCTGGTGG - Intronic
1037948624 8:23004712-23004734 AGCTCACGGGAGCCCTCTAGGGG + Intronic
1040337201 8:46422084-46422106 CCCTCACGGGAGAGCCCTGGGGG - Intergenic
1044695618 8:94919667-94919689 GCCACACTGGAACCCCCTGGTGG + Intronic
1046021129 8:108666456-108666478 GGGTCCAGGAAGCCCCCTGGTGG - Intronic
1048861530 8:138727620-138727642 GACTCACGGGTGCCCCCAGAGGG - Intronic
1048986718 8:139738751-139738773 GGCTGACTGGGGCCCCTTGGGGG - Intronic
1049211134 8:141386945-141386967 GCCACACGGGCGCCCCCTCGTGG - Intergenic
1049321499 8:141999324-141999346 GGCTGAGGGGAGCTCCCTGGGGG - Intergenic
1049366086 8:142237524-142237546 GGCTCAGGGGAGGGCCCGGGTGG - Intronic
1052695164 9:31869031-31869053 GGCTCACGGGTGGCCCATGTGGG + Intergenic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1056285371 9:85082331-85082353 GGCTCTCTGAAGCCTCCTGGGGG - Intergenic
1058851078 9:109012987-109013009 GGCTCCCGGGTGCCCCCGGCCGG - Intronic
1058915481 9:109560624-109560646 GGCTCACAGGCCCCACCTGGAGG + Intergenic
1060970636 9:127735439-127735461 GGTTCGCGGGTTCCCCCTGGAGG - Intergenic
1061015892 9:127980690-127980712 AGCTCCTGGCAGCCCCCTGGGGG - Intergenic
1061052667 9:128205394-128205416 GGCTCACAGGAGCTCCCAAGAGG + Intronic
1061458163 9:130713581-130713603 GGCTCGCGGGAGCCACCTTGGGG - Intergenic
1061507472 9:131039552-131039574 GGGGCACGGGAGGCCTCTGGAGG + Intronic
1061510508 9:131058188-131058210 GGCTCACTGCAGCCTCCTGCTGG + Intronic
1061743377 9:132723101-132723123 GACTCACGGGAGCCCCCCTAAGG - Intergenic
1062567895 9:137171356-137171378 GTCTCAGGGGAGGCCCTTGGCGG - Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1186738691 X:12494594-12494616 GGCTTTCAGGAGCCACCTGGAGG - Intronic
1188113370 X:26217023-26217045 GGGTCAAGAGAGCCCACTGGAGG - Intronic
1191851539 X:65589345-65589367 GGCTCTTGGGAGGCACCTGGTGG - Intronic
1192198499 X:69048302-69048324 TGCTCACTGGAATCCCCTGGGGG - Intergenic
1195196231 X:102500109-102500131 GCTTCACAGGAGCCTCCTGGTGG - Intergenic
1200150186 X:153947464-153947486 GGCTCACGGGAGCCCCCTGGAGG - Intergenic
1200411290 Y:2864600-2864622 GGCTCTCAGGGGACCCCTGGAGG - Intronic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic