ID: 1200150939

View in Genome Browser
Species Human (GRCh38)
Location X:153951150-153951172
Sequence GACTGTGGCCCGGTACTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200150932_1200150939 7 Left 1200150932 X:153951120-153951142 CCTCACGGCAAGGAGGGACGTGG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1200150939 X:153951150-153951172 GACTGTGGCCCGGTACTGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 104
1200150931_1200150939 8 Left 1200150931 X:153951119-153951141 CCCTCACGGCAAGGAGGGACGTG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1200150939 X:153951150-153951172 GACTGTGGCCCGGTACTGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 104
1200150930_1200150939 9 Left 1200150930 X:153951118-153951140 CCCCTCACGGCAAGGAGGGACGT 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1200150939 X:153951150-153951172 GACTGTGGCCCGGTACTGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200150939 Original CRISPR GACTGTGGCCCGGTACTGGC GGG Intronic
900408143 1:2501392-2501414 GGCTGTGGCCAGGTGCTGGTGGG + Intronic
900663731 1:3799672-3799694 GACTTTGGCCCAGTAGTGGTGGG - Intergenic
902822017 1:18949241-18949263 GACCTTGGCCAGGTCCTGGCTGG + Intronic
906699853 1:47849955-47849977 GTCTGTGGGCCAGTGCTGGCTGG - Intronic
918542624 1:185648907-185648929 GCATGTGGCGCGGGACTGGCGGG - Intergenic
922913986 1:229240743-229240765 GACTCTGACCAGGTGCTGGCTGG - Intergenic
922978729 1:229806650-229806672 GACCGTGGGCTGGTTCTGGCTGG - Intergenic
924909561 1:248496422-248496444 TACTGTGCTCTGGTACTGGCTGG + Intergenic
924914541 1:248551638-248551660 TACTGTGCTCTGGTACTGGCTGG - Intergenic
1069325876 10:67230992-67231014 GACTGTGTCCCGCACCTGGCTGG + Intronic
1072679361 10:97495237-97495259 GGCTGGGGCCAGGTAGTGGCAGG + Intronic
1076668894 10:132108357-132108379 CACTGTCCCCCGGGACTGGCAGG - Intronic
1078694788 11:13620395-13620417 GGCTGTGGCCAGGTACGTGCAGG + Intergenic
1083006432 11:59351129-59351151 GGCTGTGGCAGGGTACTAGCAGG + Intergenic
1085454011 11:76655735-76655757 GACTGTGACCTGGGAGTGGCAGG + Intergenic
1089896305 11:121933519-121933541 GGCTGTGGGCTGGTACTGGTAGG - Intergenic
1091085782 11:132720286-132720308 GGCTGTGGCCAGGTCTTGGCCGG - Intronic
1094493411 12:30975384-30975406 GACTGAGGCCGGGTGCTGGTGGG - Intronic
1095933335 12:47651119-47651141 GACCGTGGCCCAGGACTGTCAGG + Intergenic
1099190144 12:79554004-79554026 GTGTGTGGCGCGGGACTGGCAGG - Intergenic
1101013147 12:100472008-100472030 GACTGTGGCGCTGGACCGGCTGG - Intergenic
1105541333 13:21319761-21319783 GCCTGTGGCCCGCACCTGGCAGG - Intergenic
1105739071 13:23303261-23303283 GACTGTTGCCCTGAACTGCCAGG - Intronic
1106319889 13:28627389-28627411 GACTGTGGCCCTTTAGTGACTGG + Intergenic
1108028901 13:46207740-46207762 TACTGAGTCCCTGTACTGGCTGG - Intronic
1113508959 13:110836695-110836717 GACCATGGCCTGGTTCTGGCTGG - Intergenic
1113898030 13:113777961-113777983 GACTGTGGACCGGTCAGGGCTGG + Intronic
1114150414 14:20032081-20032103 GACTTTGGCCTGGTAGTGGTGGG + Intergenic
1118984539 14:70742328-70742350 GTCAGTGGCCGGGGACTGGCTGG - Intronic
1122893659 14:104744673-104744695 GGCTGTGGACCAGTACTGGTTGG - Intronic
1125260945 15:37824051-37824073 GACTGTGGGACAGTAATGGCAGG - Intergenic
1128087952 15:64898651-64898673 GACTGTGTCCTGGCTCTGGCTGG - Intronic
1131258283 15:90875635-90875657 GCCTGTGGCCCGGGGCTGACTGG - Exonic
1132869644 16:2110134-2110156 GACAGGGGCCCGGCCCTGGCCGG - Exonic
1134263888 16:12676160-12676182 GCCTGTGGCCCAGGACTGCCAGG + Intronic
1134717773 16:16365465-16365487 GACAGGGGCCCGGCCCTGGCCGG + Intergenic
1134956978 16:18386694-18386716 GACAGGGGCCCGGCCCTGGCCGG - Intergenic
1136292265 16:29282266-29282288 GAGTGTTGCCCGGGGCTGGCAGG - Intergenic
1137619358 16:49866510-49866532 AACTGTGGCCTGGTGCTGGTTGG - Intergenic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1143584963 17:7846428-7846450 GACCTTGGCTCGGTGCTGGCAGG - Exonic
1146306474 17:31733469-31733491 AAGTGTGGCCTGGTCCTGGCAGG - Intergenic
1147400296 17:40176971-40176993 GTCTGTGGGCAGGTACTGGCAGG - Intergenic
1147758270 17:42782142-42782164 GCCTGGGGCGCGGCACTGGCAGG - Intronic
1148127605 17:45244924-45244946 GACTGGGGCTGGGGACTGGCTGG + Intronic
1148674710 17:49438681-49438703 GCCTGTGGCCAGGCACGGGCGGG - Intronic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1164609237 19:29621059-29621081 GGCTGTGGCTGGGTGCTGGCAGG - Intergenic
1165554626 19:36619449-36619471 GACTTTGGCCTGGTAGTGGTGGG + Intronic
1166589977 19:43988458-43988480 GACTGTGGCACGTTTCAGGCAGG + Exonic
925635415 2:5937393-5937415 GACTGAGGCCAGGGACAGGCAGG + Intergenic
926192847 2:10741547-10741569 GACAGTGGCCGGGCACTGGCGGG + Intronic
934655044 2:96113001-96113023 GACTGTGACCCTCTGCTGGCCGG - Exonic
940361864 2:152804788-152804810 CACAGTGGCACGGGACTGGCAGG - Intergenic
948693714 2:239722320-239722342 GCGTGTGGCCCGGTGCTGCCGGG - Intergenic
1169944810 20:10977454-10977476 GGCGGTGGTCTGGTACTGGCAGG + Intergenic
1174587245 20:51618744-51618766 GACTACGGCCGGGCACTGGCAGG + Exonic
1176172623 20:63702890-63702912 GACTCTGGCCCTGTCCTGGCAGG - Intronic
1181801447 22:25350507-25350529 GACTGTGCTCCGGGGCTGGCTGG + Intergenic
1183727832 22:39599283-39599305 GACTCTGGCCCAGTGCTGCCTGG - Intronic
1184039349 22:41933907-41933929 GACAGTGGCTCGGTACGGGCTGG - Intergenic
1185318057 22:50187221-50187243 GACTGTGACCAGGTCCTGGGAGG + Intronic
954871553 3:53771144-53771166 GTCTGGGGCAGGGTACTGGCAGG - Intronic
956657110 3:71563119-71563141 GACTGTGGCCAGGGAGTGGCTGG + Intronic
963853298 3:150228376-150228398 GGCTGTGGACCGGCTCTGGCTGG + Intergenic
965741449 3:171879375-171879397 GAATGTGGCTCTGGACTGGCAGG + Intronic
968699552 4:2048063-2048085 GGCTGTGGCCCTGTAAGGGCTGG + Intergenic
970430471 4:15984507-15984529 GGCTGTGGACCGGTACTAGCTGG - Intronic
974027341 4:56745318-56745340 GACTGTGGACTGGTTCTAGCTGG + Intergenic
974069909 4:57114070-57114092 GCTTCTGGCCCTGTACTGGCTGG - Intergenic
974853945 4:67436942-67436964 GACTGTGGCCAGCTGCTGGTTGG - Intergenic
978576575 4:110196313-110196335 GACTGTGGGCCCGAACAGGCCGG + Intronic
982920447 4:161267360-161267382 GACTGTGGCCCTGTAATGGGTGG + Intergenic
984941771 4:184939041-184939063 GGCTGTGGACTGGTACTGGTCGG - Intergenic
985627484 5:997073-997095 GACTGTGGACTGGTTCTAGCTGG + Intergenic
985952516 5:3234497-3234519 GGGTGTGGCCCCGCACTGGCGGG + Intergenic
994643021 5:102433786-102433808 GGCTGTGGCAGGGTGCTGGCAGG + Intronic
996451411 5:123629365-123629387 CGCTGTGGCAGGGTACTGGCGGG - Intergenic
1002159734 5:177308030-177308052 GGCCGTGGCCCGGTACTGAGTGG - Intronic
1015468025 6:133569356-133569378 TACTGTGGCCGGTTCCTGGCTGG + Intergenic
1017175019 6:151494322-151494344 GGCTGTGGCCTGGGACTGCCAGG + Intronic
1017383441 6:153856903-153856925 GCGTGTGGCACGGGACTGGCGGG - Intergenic
1019534876 7:1523667-1523689 GACTGGAGCCCGGAACAGGCTGG - Intergenic
1019794633 7:3040799-3040821 GACTGTGGCTTGGTGGTGGCTGG - Intronic
1019978457 7:4603260-4603282 GACTGTGGCCCGGCGGAGGCCGG - Intergenic
1021425697 7:20496570-20496592 AACTGTGGCAGGGTACTAGCGGG - Intergenic
1021450290 7:20778097-20778119 GTCAGAGGCCCGGGACTGGCGGG + Intergenic
1022793907 7:33716781-33716803 AACTGTTGCCCTCTACTGGCTGG - Intergenic
1026895622 7:74008409-74008431 GAGTGAGGCCCGGTCCTGGGAGG - Intergenic
1027426129 7:78062894-78062916 GACTGTGGCCCTGGGCTGGGTGG - Intronic
1030733558 7:113017733-113017755 CACGGTGGCGCGGGACTGGCAGG + Intergenic
1031093360 7:117389595-117389617 GACTTTGGCCTGGTAGTGGTAGG - Intronic
1036705617 8:11044138-11044160 GACCGTGGACTGGTTCTGGCTGG + Intronic
1037768260 8:21784797-21784819 GTTTGAGGCCCGGCACTGGCTGG + Intronic
1039759509 8:40559222-40559244 GACTGTGAACTGGTTCTGGCTGG + Intronic
1043398081 8:79857897-79857919 GACTGGGCCTCGGGACTGGCCGG + Intergenic
1048973976 8:139661101-139661123 GACTTTGGCCTGGGAGTGGCTGG - Intronic
1051511093 9:17878715-17878737 GATAGTGGCCCTGTACTTGCTGG - Intergenic
1052903950 9:33817639-33817661 GACCGGGGCCCGGTGCTGCCCGG + Exonic
1058449377 9:105081710-105081732 AACTGAGGCCAGGTACTGTCAGG + Intergenic
1058864057 9:109145266-109145288 GACTGTGGCCAGGCACAGGCGGG - Intronic
1060155603 9:121317954-121317976 GACTGAGGCCCAGCACTGGCTGG + Intronic
1060817648 9:126643702-126643724 CCCTGTGGCCCTGTACTGACAGG - Intronic
1060937097 9:127522123-127522145 GACTGTGGGCTGGGACTGGGTGG - Intronic
1061871482 9:133523074-133523096 GACAGTGGCCTGGGACAGGCTGG - Intronic
1062339227 9:136086528-136086550 GACCGTGGCTGGGTGCTGGCAGG - Intronic
1062516705 9:136940562-136940584 GACGGTGGCCCAGTGGTGGCAGG - Exonic
1062637999 9:137501523-137501545 GGCAGTGGCCCGGTGCTGGGAGG + Intronic
1062645680 9:137547003-137547025 GAGTATGGCCAGTTACTGGCAGG - Intronic
1203791010 EBV:151532-151554 GGCCGTGGCCAGGTACGGGCTGG - Intergenic
1189298573 X:39936086-39936108 GCCGGTGGCCCAGCACTGGCAGG + Intergenic
1189567265 X:42255487-42255509 GACTCTGGGCTGGTACTGGGGGG - Intergenic
1190872990 X:54440407-54440429 GACTGGGGCCGGATAATGGCGGG + Exonic
1192245109 X:69365541-69365563 GACTGTGGCCAGGCACTTCCTGG + Intergenic
1200150939 X:153951150-153951172 GACTGTGGCCCGGTACTGGCGGG + Intronic