ID: 1200151222

View in Genome Browser
Species Human (GRCh38)
Location X:153952387-153952409
Sequence CTCGTCCTCCCCATCACATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200151212_1200151222 28 Left 1200151212 X:153952336-153952358 CCTGTTCTACACGGCAGTCTCTA 0: 1
1: 0
2: 1
3: 3
4: 67
Right 1200151222 X:153952387-153952409 CTCGTCCTCCCCATCACATCTGG 0: 1
1: 0
2: 0
3: 26
4: 147
1200151218_1200151222 -7 Left 1200151218 X:153952371-153952393 CCTGGGGTCCCCTGTGCTCGTCC 0: 1
1: 1
2: 2
3: 11
4: 184
Right 1200151222 X:153952387-153952409 CTCGTCCTCCCCATCACATCTGG 0: 1
1: 0
2: 0
3: 26
4: 147
1200151217_1200151222 -3 Left 1200151217 X:153952367-153952389 CCTGCCTGGGGTCCCCTGTGCTC 0: 1
1: 0
2: 5
3: 46
4: 563
Right 1200151222 X:153952387-153952409 CTCGTCCTCCCCATCACATCTGG 0: 1
1: 0
2: 0
3: 26
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200151222 Original CRISPR CTCGTCCTCCCCATCACATC TGG Intronic
901082587 1:6591900-6591922 CTCGGCCTTCCCAGCACAGCAGG + Exonic
901875274 1:12163928-12163950 CTCTCCCTCCCCAGCACATTTGG - Intergenic
902637667 1:17745199-17745221 CTCCTCCTCCTCATGACATGAGG + Intergenic
904684209 1:32248787-32248809 CTCCTCCTCCCCCTCCCAGCTGG - Exonic
905285149 1:36874489-36874511 TTCCTCCTCCCCATCAAGTCTGG - Intronic
912384868 1:109266222-109266244 CATGTCCTCGACATCACATCGGG - Intronic
915704900 1:157834491-157834513 CTCGTCCTGAGCATGACATCTGG + Exonic
918212892 1:182367281-182367303 CTCATCCTCCACACCACATCTGG - Intergenic
919295783 1:195698277-195698299 CTCCCCCACCCCACCACATCCGG + Intergenic
922771264 1:228184594-228184616 CATGTCCTCCCCAGCACATGGGG + Intergenic
1062810464 10:459650-459672 GTCTTCCTCCCAGTCACATCAGG + Intronic
1062810482 10:459751-459773 ATCTTCCTCCCAGTCACATCAGG + Intronic
1063027214 10:2192233-2192255 CTTGGCCTCCCAATCACAGCTGG + Intergenic
1068646952 10:59478793-59478815 CTCATCCTCTCCTTCACATCTGG - Intergenic
1069682725 10:70296728-70296750 CCCTTCCTGCCCTTCACATCTGG + Intergenic
1070641581 10:78174143-78174165 GTCATCCTCCCCAACACTTCAGG + Intergenic
1072747675 10:97952687-97952709 CTGGTCCTTCCAATCTCATCAGG + Intronic
1072763017 10:98073319-98073341 GTCCTCCTCCCCATCACCTTTGG - Intergenic
1073688880 10:105785682-105785704 CTGGTCCTGCCCTTCACATGTGG - Intergenic
1075710809 10:124529663-124529685 CTCGTCCTCCCCCTCACGGATGG - Intronic
1076434714 10:130432288-130432310 CTTGTCCTCTCCATCTCATTTGG + Intergenic
1076711268 10:132336112-132336134 TTCTTCCTCCCCAGCACCTCTGG - Intronic
1076737101 10:132463801-132463823 CACGTCCTGCCCATCTCCTCAGG - Intergenic
1078059216 11:8032632-8032654 CTCTTCCTCTCCCTCACACCTGG + Intronic
1080702592 11:34656998-34657020 TTGGTCCTTCCCATCACATCGGG + Intronic
1081611937 11:44568155-44568177 ATCCTCCACCCCAGCACATCTGG - Intronic
1085402029 11:76241212-76241234 CCTGTCCTCCCCATCCCAGCTGG + Intergenic
1086231325 11:84573728-84573750 CTTTTCCTCCCCATGACATCTGG - Intronic
1089073283 11:115717357-115717379 CAGGGCCTCCCCATCTCATCTGG - Intergenic
1089785669 11:120905216-120905238 CTGGCCCTCCCCATCACACGCGG + Intronic
1091121313 11:133060220-133060242 CTCCTTCTCCCCATCCCCTCAGG + Intronic
1091755491 12:3048604-3048626 CTGGCCCACACCATCACATCTGG + Intergenic
1094395299 12:29998925-29998947 TGCCTCCTCCCCATCACAACAGG - Intergenic
1096761180 12:53843329-53843351 CACATCATCCCCATCACACCAGG - Intergenic
1096911690 12:54990547-54990569 CTCTCCCTTCCCATCACATGAGG - Intergenic
1097221732 12:57455158-57455180 GTCCTCCTCCCCATCAGCTCAGG - Intronic
1102927468 12:116837160-116837182 CTCCTCCTCCTCCTGACATCAGG + Intronic
1103712060 12:122920021-122920043 CTCAGCCTCCCCACCACACCTGG + Intergenic
1105894910 13:24709500-24709522 CGCGTCTTCCCCATCACACGAGG + Intronic
1112825181 13:103383551-103383573 CTGGTCCTCCCCTTGACATGTGG + Intergenic
1113329713 13:109316544-109316566 CTGGTCCTTCCCATGACATGTGG + Intergenic
1113359739 13:109619290-109619312 CTGGTCCTCCCCATGACATGTGG + Intergenic
1113821966 13:113221071-113221093 CGCATCCTCCCCATCCCTTCAGG - Intronic
1114516098 14:23301356-23301378 CTACTCCTCCCCGCCACATCGGG + Exonic
1114566292 14:23635674-23635696 CTCGTCCTCCACATCCACTCTGG + Intronic
1122368538 14:101214022-101214044 CTCATCCTCCCCCTCAGCTCAGG - Intergenic
1122695853 14:103551737-103551759 CTCAACCACCCCATCACATCCGG + Intergenic
1124997005 15:34733257-34733279 TTGTTACTCCCCATCACATCAGG + Intergenic
1128376648 15:67081281-67081303 CTAGTCATCCCCATGACACCAGG - Intronic
1129271125 15:74419760-74419782 CTCTTCCTCCCCAGCAACTCTGG + Intronic
1131232888 15:90672266-90672288 CTCTCTCTCCCCATCACATGAGG + Intergenic
1131292450 15:91118499-91118521 CTGCTCCTCCCCTACACATCAGG - Intronic
1133238775 16:4402756-4402778 CGCGTCCTCCCCGGCTCATCAGG + Intronic
1136274525 16:29170612-29170634 CTCCTCCTCCTCATCCCATCCGG + Intergenic
1137552058 16:49444352-49444374 CTCGTCCTTACCCTCAGATCAGG + Intergenic
1142078812 16:88136266-88136288 CTCCTCCTCCTCATCCCATCTGG + Intergenic
1142874573 17:2843809-2843831 CACGTCCTCCCAATCACAGGGGG - Intronic
1144761920 17:17711820-17711842 CTCCTCCTGCGCACCACATCTGG + Intronic
1145815337 17:27791401-27791423 GTCGTCCTCCCCATCTGATCAGG + Intronic
1146544221 17:33724517-33724539 CTCCTCCGCTCCTTCACATCTGG - Intronic
1146688997 17:34860158-34860180 CTCTTCCTCCCGTTCCCATCTGG + Intergenic
1146707428 17:35011545-35011567 GTCCTCCTCCCCAGCACATTCGG - Exonic
1149507846 17:57210884-57210906 TTTGTTCTCCCCATCACATAGGG - Intergenic
1151365857 17:73616140-73616162 CTCCTCTTCCCCAGAACATCAGG + Intronic
1152829996 17:82491208-82491230 CTCCTCCTCCTCCTCACACCAGG - Intergenic
1153762686 18:8347079-8347101 CTCTTTCTCCCCATCACATGTGG - Intronic
1155413395 18:25570809-25570831 CTGGTCCTTCCCATGACATGTGG + Intergenic
1156620942 18:38850839-38850861 CTCCTTCTCCACATCACTTCAGG + Intergenic
1157326659 18:46674014-46674036 CTGGTCTTCCCCTTCGCATCTGG + Intronic
1158185118 18:54762719-54762741 TTCCTCCTCCCCAACACACCGGG + Intronic
1160090149 18:75819196-75819218 TTCTTCCTCTCCATCACATCAGG - Intergenic
1160152642 18:76406764-76406786 CTCTTTCTCACCATCACAGCAGG + Intronic
1160332345 18:78006127-78006149 CTCTCCCTCCACATCACTTCAGG + Intergenic
1161617807 19:5281913-5281935 CCCGTCCTCCTCCTCTCATCTGG + Intronic
1163393711 19:17046275-17046297 CTAATCCTCCCAAGCACATCAGG - Intergenic
1164448143 19:28335065-28335087 CTCGGGCTGCCCATCTCATCAGG - Intergenic
1164582486 19:29442989-29443011 CTCCTCCTCTCCTTCATATCAGG - Intergenic
1168201587 19:54819283-54819305 CTCGTGCCCACCACCACATCTGG - Intronic
925354536 2:3228673-3228695 CTGGTCCTGCCCTTCACATGTGG - Intronic
925719144 2:6811402-6811424 CTCCTGCTCCCCACCACATCTGG + Intergenic
926314266 2:11697801-11697823 CCCCTCCTCCCCATCTCACCAGG + Intronic
928631947 2:33202740-33202762 CTCTTCCTCCCCATCGCCTAAGG + Intronic
930011392 2:46940953-46940975 CGCCCCCTCCCCATCCCATCGGG - Intronic
931949707 2:67349341-67349363 CTGGTCCTTCCCATGACATGTGG + Intergenic
932928633 2:76006601-76006623 TTTGTCCTTCCCATGACATCTGG - Intergenic
933366584 2:81361569-81361591 TTCATTCTCCCCATCACATCAGG + Intergenic
933658299 2:84906463-84906485 CTCTTCCTCCACATCACGACTGG - Exonic
934083090 2:88486289-88486311 CTCCTCCCCTCCAACACATCAGG - Intergenic
935112017 2:100103725-100103747 CTCCTCCTCCCCACCCCACCCGG - Intronic
936122956 2:109761426-109761448 CTCCTCCTCCCCACCCCACCCGG + Intergenic
936221731 2:110610038-110610060 CTCCTCCTCCCCACCCCACCCGG - Intergenic
937020422 2:118646003-118646025 CTCGGCCTCCCAATCACTCCTGG + Intergenic
940435044 2:153641490-153641512 CTCATTCTCCCCATCCCATTTGG + Intergenic
941260537 2:163291533-163291555 CTGGTCCTTCCCACCACATATGG - Intergenic
944297793 2:198086476-198086498 CACGTGCTCGCCACCACATCTGG - Intronic
944970239 2:204984684-204984706 CTCCTCCTAACCATGACATCTGG - Intronic
946356253 2:219187355-219187377 CACATCCTCCTCATCTCATCTGG + Intergenic
947049526 2:226026647-226026669 CTGGTCCTTCCCATAACATGTGG - Intergenic
948168582 2:235882300-235882322 CTCTTCCTCCACATCACAACTGG + Intronic
1169429832 20:5526395-5526417 CTGTTCCTGCTCATCACATCTGG + Intergenic
1172603547 20:36199831-36199853 CTCATCCTCCCCTTCTCTTCTGG - Intronic
1173826890 20:46053520-46053542 CTGGATCTCCTCATCACATCTGG + Intronic
1175603266 20:60292161-60292183 CTGGTCCTGCCCTTCACATGTGG - Intergenic
1176250847 20:64119164-64119186 CAGGCCCTCCCCACCACATCAGG - Intergenic
1177620089 21:23578865-23578887 CGGGTCCTCCCCACCACACCAGG + Intergenic
1178322630 21:31617001-31617023 CACGTGCCCTCCATCACATCCGG + Intergenic
1179103681 21:38379087-38379109 CCAGTCCTCCCCAAAACATCTGG - Intergenic
1179315944 21:40244588-40244610 CTCGTGCGCCCCATCCCTTCAGG - Intronic
1179651062 21:42809181-42809203 ATCTTCCTCCCCATCCCATGGGG - Intergenic
1180825382 22:18857668-18857690 CTCCTCCTGGCCATCACATCAGG - Intronic
1181187349 22:21116879-21116901 CTCCTCCTGGCCATCACATCAGG + Intergenic
1181211849 22:21293614-21293636 CTCCTCCTGGCCATCACATCAGG - Intergenic
1181397651 22:22633272-22633294 CTCCTCCTGGCCATCACATCAGG + Intergenic
1181500399 22:23312642-23312664 CTCCTCCTGGCCATCACATCAGG + Intronic
1181651754 22:24262786-24262808 CTCCTCCTGGCCATCACATCAGG - Intergenic
1181705621 22:24647953-24647975 CTCCTCCTGGCCATCACATCAGG + Intergenic
1182224954 22:28790390-28790412 CTCCTCCTGCCCACCAAATCAGG - Intergenic
1183057782 22:35317766-35317788 TTCCTCCTCCCCATCTCATCCGG + Intronic
1184099467 22:42334428-42334450 CCTGTCCTCCCCATCACCTGGGG + Intronic
1203215104 22_KI270731v1_random:1818-1840 CTCCTCCTGGCCATCACATCAGG + Intergenic
1203275529 22_KI270734v1_random:83571-83593 CTCCTCCTGGCCATCACATCAGG - Intergenic
950980883 3:17303205-17303227 GTGGTCCTCCACCTCACATCTGG - Intronic
958090330 3:88869384-88869406 CTGGTCCTTCCCATGACATGGGG + Intergenic
960030835 3:113053358-113053380 TTCTTCCTCCCCTTCACATTGGG + Intergenic
960037092 3:113112716-113112738 TTCTTCCTCTCCATCCCATCTGG - Intergenic
960895152 3:122496483-122496505 CTCCTCCTGCGCATCTCATCGGG + Exonic
961009882 3:123428637-123428659 CTGGGACTCCCCATCACTTCAGG + Intronic
964928606 3:161987333-161987355 TTTGTCCTCCCAATCTCATCGGG - Intergenic
968456679 4:704033-704055 CCAGTCCTCCCCTCCACATCTGG + Intergenic
969420989 4:7095727-7095749 ATGGTCCTCCCCAGCACACCGGG - Intergenic
972890856 4:43554350-43554372 CTTGTCCTTCCCATGACATGGGG - Intergenic
973686748 4:53377888-53377910 CTCTTCCTCCTCATCCCCTCCGG - Exonic
976050590 4:81008094-81008116 CTGGTCCTTCCCATGACATGTGG - Intergenic
978437547 4:108701757-108701779 GTCTTCCTCCCCAGCACCTCAGG - Intergenic
985688815 5:1295565-1295587 TCCGTCCTCCCCTTCACGTCCGG - Intergenic
986798227 5:11232856-11232878 CTGGTCCTACCCTTGACATCTGG - Intronic
987503120 5:18738485-18738507 CTCCTCTTCCCCAACACTTCAGG + Intergenic
988562612 5:32294443-32294465 CTGGTGCCCACCATCACATCTGG + Intronic
992484305 5:77180518-77180540 CTCGGCCGCCCCCTCACACCTGG + Intergenic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
995099286 5:108278801-108278823 CATGGCCTCCCCATCACAGCTGG + Intronic
997599480 5:135129648-135129670 CACGTCCTCCCCAGCACTCCAGG - Intronic
999223293 5:149999537-149999559 CTCCTCCTTCACCTCACATCCGG - Intronic
1008082199 6:47206284-47206306 CTTGTGCTCCACATAACATCTGG + Intergenic
1008185006 6:48377988-48378010 CCCCACCTCCCCATCACTTCTGG + Intergenic
1013298139 6:108778426-108778448 AGCGTCCTCCCCATCGCCTCTGG - Intergenic
1013307470 6:108862936-108862958 CTCTTTCTCCCCATCCTATCTGG + Intronic
1014987533 6:128030021-128030043 CTAGTGCTCCCCGTGACATCAGG - Intronic
1017713381 6:157190147-157190169 GGCATCCTGCCCATCACATCGGG - Exonic
1022895600 7:34747876-34747898 CTCGTCCCACCCATCACCCCAGG - Intronic
1029673410 7:102049586-102049608 CTCGGCCTCTCCATCACACCTGG - Intronic
1031697302 7:124874200-124874222 TTCCTCCTCACCATCACATTAGG + Intronic
1035035958 7:155893890-155893912 CTCCTCCTCCCCACTGCATCTGG + Intergenic
1036286697 8:7449114-7449136 CCCATCCTCCCCATCTCACCTGG + Intronic
1036334781 8:7862409-7862431 CCCATCCTCCCCATCTCACCTGG - Intronic
1038235810 8:25753139-25753161 CTCATCCTCCCCAGCTCAGCAGG - Intergenic
1039076796 8:33697771-33697793 CTCATCCTCACCATCTCTTCAGG - Intergenic
1039078881 8:33716713-33716735 CTTGTTCTCTCCATCAAATCTGG - Intergenic
1045885596 8:107094052-107094074 CTCCTCCACCCCTTCACCTCCGG + Intergenic
1048607802 8:135987926-135987948 CTCCTCCTCCTCATCACAGCTGG + Intergenic
1048673211 8:136747153-136747175 CTGGTCCTGCCCTTGACATCTGG - Intergenic
1049164380 8:141117245-141117267 CACCTCCTCCCCCTCGCATCTGG - Intergenic
1049640114 8:143711627-143711649 TCCGTCCTCCCCACCACAGCTGG + Intronic
1049866361 8:144940330-144940352 CTCAGCCTCCCAATCACACCTGG + Intronic
1053465296 9:38302687-38302709 CTCCTTCTCCCCATCACTTTTGG + Intergenic
1056558072 9:87706415-87706437 CTCGTCCTCCTCATCAGCCCAGG - Exonic
1060190286 9:121588415-121588437 CCCGTCCTCCTCATCCCAACTGG + Intronic
1062395608 9:136351433-136351455 CTGGCTCTGCCCATCACATCTGG + Intronic
1185630432 X:1512812-1512834 CTGGTCCTGCCCTTCACATGTGG + Intronic
1186293071 X:8121178-8121200 CTCTTCCTCACCATCGTATCGGG + Intergenic
1186425760 X:9464099-9464121 CTCCCCCTCCCCAGCACCTCTGG - Intronic
1198022684 X:132674817-132674839 CTGGGCTTCTCCATCACATCAGG + Intronic
1200151222 X:153952387-153952409 CTCGTCCTCCCCATCACATCTGG + Intronic
1202148246 Y:21822257-21822279 CTGGACATCCCCATCACAACAGG + Intergenic