ID: 1200151289

View in Genome Browser
Species Human (GRCh38)
Location X:153952635-153952657
Sequence GAGCCCCGTTACCATGAGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200151282_1200151289 2 Left 1200151282 X:153952610-153952632 CCGTCACTGCCAGCTCCTCGGGG 0: 1
1: 0
2: 0
3: 32
4: 544
Right 1200151289 X:153952635-153952657 GAGCCCCGTTACCATGAGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 62
1200151279_1200151289 26 Left 1200151279 X:153952586-153952608 CCTGGGCAGCTGCTTCTGCAGCA 0: 1
1: 0
2: 5
3: 39
4: 495
Right 1200151289 X:153952635-153952657 GAGCCCCGTTACCATGAGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 62
1200151285_1200151289 -7 Left 1200151285 X:153952619-153952641 CCAGCTCCTCGGGGGTGAGCCCC 0: 1
1: 0
2: 0
3: 13
4: 187
Right 1200151289 X:153952635-153952657 GAGCCCCGTTACCATGAGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200151289 Original CRISPR GAGCCCCGTTACCATGAGGG TGG Exonic
900534517 1:3170401-3170423 CAGCCCCATCACCATGTGGGTGG + Intronic
900667884 1:3827854-3827876 GAGCCCCAGCTCCATGAGGGTGG + Intronic
912392144 1:109310773-109310795 CAGCCCCGTTACCCTGGGGTGGG + Exonic
913451138 1:118993375-118993397 GAGCCCACTGAGCATGAGGGAGG + Intergenic
919825185 1:201498516-201498538 AAGCCCTGTTACCAGGAGGGTGG - Intronic
922702674 1:227771013-227771035 GAGCCCAGTCACCTTGGGGGTGG - Intronic
1062764199 10:48758-48780 GGGCCGCGTTCCCAGGAGGGCGG + Intronic
1084332504 11:68438265-68438287 GGGCCACGTTACCCTGAGGTTGG + Intronic
1084387921 11:68855576-68855598 GAGCCCCGAGACCCGGAGGGAGG + Intergenic
1085012285 11:73149592-73149614 CAGCCCAGTTCCCATGAGGAAGG - Intergenic
1087857055 11:103104709-103104731 GAGCCCCCTAACCTTGAGTGTGG + Intergenic
1089535533 11:119158699-119158721 GAGCACAGTTGGCATGAGGGCGG - Exonic
1089784540 11:120898629-120898651 GAGCCCACTTACCAGGATGGTGG - Exonic
1095949977 12:47776527-47776549 GAGCTCCCTTCCCAGGAGGGTGG + Intronic
1121232639 14:92369005-92369027 GAGCCCCATCATCCTGAGGGAGG + Intronic
1121250133 14:92493215-92493237 GAGGGCCGGTCCCATGAGGGCGG + Intronic
1131360058 15:91782692-91782714 GGGCCCCCTTACTAAGAGGGTGG - Intergenic
1131809231 15:96155121-96155143 AAGCCCCTTTACAATGAAGGTGG + Intergenic
1132669356 16:1096356-1096378 CAGCCCCGTGCCCATGAGCGGGG + Intergenic
1138193915 16:55038417-55038439 GAGCCCCTTTAGCATGGGGAAGG - Intergenic
1141824381 16:86468666-86468688 GAGCACAGTCACCGTGAGGGGGG + Intergenic
1142440456 16:90094474-90094496 GGGCCGCGTTCCCAGGAGGGCGG - Intergenic
1144319403 17:14099554-14099576 GTGTCCAGTAACCATGAGGGGGG - Intronic
1152610479 17:81312884-81312906 GAACCCCGTGACCAGGAGTGGGG + Exonic
1152957110 18:49083-49105 GGGCCGCGTTCCCAGGAGGGCGG + Intronic
1153678368 18:7476619-7476641 GAGCCCTGTGACCATGACGGAGG - Intergenic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
926004777 2:9365314-9365336 GGGCCCAGTTAACATCAGGGAGG + Intronic
926923024 2:17958121-17958143 GAACCCCATGACCCTGAGGGTGG + Intronic
930210208 2:48628914-48628936 GAGTCCAGTTAACAAGAGGGAGG + Intronic
934527210 2:95059367-95059389 GAGCCCAGGTCCCAGGAGGGTGG + Intergenic
938084685 2:128391015-128391037 GAGAACTGATACCATGAGGGAGG + Intergenic
941549790 2:166900916-166900938 GAGCCCCGTCACCATCAAGTGGG + Intronic
944756274 2:202765169-202765191 CAGCCCCATTACCATGCAGGTGG - Intronic
947843895 2:233228328-233228350 GAGCCCAGTTACCTTGAGAAAGG - Intronic
1174759003 20:53187932-53187954 GAGCCATGTTACCAGGAGGCGGG - Intronic
1178033446 21:28554879-28554901 CAGCCCCGTTTCCATGGGAGTGG - Intergenic
1183357788 22:37368759-37368781 GAGCCCCCTTTCCATGAGTGTGG - Exonic
1184728574 22:46360059-46360081 GAGCCCTGTTTCCTTAAGGGTGG + Intergenic
1185017219 22:48351820-48351842 GAGCCCCGTCTCCATGATGAAGG - Intergenic
950117574 3:10461466-10461488 GAACACCTTTACCATGAGGGAGG - Intronic
954404309 3:50337054-50337076 GAGCCACGTAGCCAGGAGGGTGG + Intronic
961502783 3:127349847-127349869 GAGCCCTGTGTCCAGGAGGGAGG - Intergenic
965646515 3:170887648-170887670 TAGCCCAGTTACCCAGAGGGAGG - Intergenic
972860968 4:43168978-43169000 CAGCCCCCTTTCCATGAGAGTGG - Intergenic
974998842 4:69195833-69195855 GATCTCCGTTGCCATTAGGGAGG - Intronic
985441377 4:189984398-189984420 GGGCCGCGTTCCCAGGAGGGCGG + Intergenic
1002881296 6:1254740-1254762 AGGCCCTGTCACCATGAGGGTGG - Intergenic
1002962930 6:1933481-1933503 GAGCCCTGTTACCCTGCTGGTGG - Intronic
1005294605 6:24413113-24413135 GAGCCCAGTTACCAAGCAGGGGG + Intronic
1007264771 6:40587888-40587910 GAGCCCCGGAACCGGGAGGGCGG + Intergenic
1007274691 6:40664659-40664681 GAGCCCAGATACCATGAAGAAGG - Intergenic
1007711632 6:43827938-43827960 GAGGCACCCTACCATGAGGGTGG + Intergenic
1020097628 7:5377486-5377508 GCCCCCCGTCACCATGAGGTTGG + Exonic
1020638791 7:10729971-10729993 GAGCCCTGGTACCCTGAGGTGGG - Intergenic
1025260717 7:57415838-57415860 AAGCCCCGTTACCCAGATGGAGG - Intergenic
1027000368 7:74648907-74648929 GAGCCTCTTTAGCATGAGGGTGG + Intergenic
1033259369 7:139829311-139829333 GAGCACGGTTCCCATAAGGGCGG + Exonic
1039110310 8:34034620-34034642 GAGCCACTTTACCGTGAAGGAGG - Intergenic
1039681112 8:39737488-39737510 CACACCCGTTACCATGAGGATGG + Intergenic
1039788766 8:40857090-40857112 GAGCCTGGTTACCTGGAGGGAGG + Intronic
1041279691 8:56197777-56197799 AAGCCCTGTTACCATGGGGGTGG - Intronic
1045788574 8:105955168-105955190 GACCCCCGGTAACATTAGGGTGG - Intergenic
1057703010 9:97377068-97377090 GAGCCCTCTTCCCATGAGGAAGG + Intronic
1062741057 9:138175546-138175568 GGGCCGCGTTCCCAGGAGGGCGG - Intergenic
1188629139 X:32329479-32329501 GAGACCCTTTCCCATTAGGGAGG + Intronic
1190073201 X:47295677-47295699 GAACCCAGTTTCCATGAGGTGGG + Intergenic
1200151289 X:153952635-153952657 GAGCCCCGTTACCATGAGGGTGG + Exonic
1201039092 Y:9811114-9811136 GAGCCCCGTGACAATGAGAATGG + Intergenic