ID: 1200151318

View in Genome Browser
Species Human (GRCh38)
Location X:153952754-153952776
Sequence GTCTGCCGGCTCTGCGGTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200151318_1200151333 28 Left 1200151318 X:153952754-153952776 CCACCACCGCAGAGCCGGCAGAC 0: 1
1: 0
2: 0
3: 15
4: 121
Right 1200151333 X:153952805-153952827 TGCTCAGATCCACGGCGGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 81
1200151318_1200151329 20 Left 1200151318 X:153952754-153952776 CCACCACCGCAGAGCCGGCAGAC 0: 1
1: 0
2: 0
3: 15
4: 121
Right 1200151329 X:153952797-153952819 CCCTGTGCTGCTCAGATCCACGG 0: 1
1: 0
2: 0
3: 34
4: 258
1200151318_1200151323 -6 Left 1200151318 X:153952754-153952776 CCACCACCGCAGAGCCGGCAGAC 0: 1
1: 0
2: 0
3: 15
4: 121
Right 1200151323 X:153952771-153952793 GCAGACTCCTGGCCCGAAGATGG 0: 1
1: 0
2: 0
3: 12
4: 127
1200151318_1200151331 23 Left 1200151318 X:153952754-153952776 CCACCACCGCAGAGCCGGCAGAC 0: 1
1: 0
2: 0
3: 15
4: 121
Right 1200151331 X:153952800-153952822 TGTGCTGCTCAGATCCACGGCGG 0: 1
1: 0
2: 0
3: 15
4: 128
1200151318_1200151332 27 Left 1200151318 X:153952754-153952776 CCACCACCGCAGAGCCGGCAGAC 0: 1
1: 0
2: 0
3: 15
4: 121
Right 1200151332 X:153952804-153952826 CTGCTCAGATCCACGGCGGCCGG 0: 1
1: 0
2: 0
3: 9
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200151318 Original CRISPR GTCTGCCGGCTCTGCGGTGG TGG (reversed) Exonic
902414376 1:16230293-16230315 GCCTGCAGGCTCTGAGGTGGGGG + Intergenic
902551206 1:17220640-17220662 GGCTGATGGCTCTGCCGTGGGGG + Intronic
903349795 1:22710840-22710862 TTCTGCTGGCTGCGCGGTGGCGG + Intronic
905548824 1:38819676-38819698 GTCTCCTGGCCCTGAGGTGGAGG - Intergenic
906539028 1:46570645-46570667 GTCTGCCCCCTCTGCTGTTGCGG - Intronic
906903674 1:49865240-49865262 CTCTGCCTGCTCTTTGGTGGAGG - Intronic
922214129 1:223506961-223506983 GGCTCCAGGCTCAGCGGTGGTGG + Intergenic
922796265 1:228341254-228341276 GTCTGCAGGCTCTGGGCTGCTGG + Intronic
923226672 1:231944240-231944262 GTCTACCTGCTCTGTGGTGGGGG + Intronic
924615896 1:245611818-245611840 GGCAGCCTTCTCTGCGGTGGGGG - Exonic
1062811563 10:470343-470365 GTCTGCAGGCTCTGCTCTGGAGG - Intronic
1067557263 10:47281658-47281680 GTCTGATGGCTCTGATGTGGGGG + Intergenic
1068334831 10:55621408-55621430 GTCTGCAGCCCCTGGGGTGGGGG - Intronic
1069806321 10:71127215-71127237 GGCTGAGGGCTCTGCGATGGGGG + Intergenic
1073573121 10:104597574-104597596 GGCTGTCGGCACTGCTGTGGTGG + Intergenic
1075279995 10:121130827-121130849 GTCTGCAGCATCTGTGGTGGCGG - Intergenic
1075748490 10:124744235-124744257 GTCTGGCGGCTCCGCGGCGGCGG - Intronic
1077128886 11:959273-959295 TCCTGCCGGCTCTGGGTTGGAGG + Intronic
1078426811 11:11258244-11258266 GGTTGCCTGCTCTGCGGAGGAGG - Intergenic
1089286917 11:117413168-117413190 ATCAGCAGGCTCTGGGGTGGGGG + Exonic
1096513830 12:52145751-52145773 GCCTGCCTGCCCTGCGGAGGTGG - Intergenic
1096782018 12:53997065-53997087 GCCTGCCCACTCTGCGGAGGCGG - Intronic
1100582510 12:95948553-95948575 GTCGGCTGGCTGGGCGGTGGGGG - Intronic
1102787178 12:115614472-115614494 GTCTGGGGACTCTGAGGTGGTGG - Intergenic
1103912942 12:124362206-124362228 GGCTGCAGGTTTTGCGGTGGCGG + Exonic
1104910446 12:132237827-132237849 ATCTGCCAGGCCTGCGGTGGAGG + Intronic
1109538086 13:63741474-63741496 GCCTCCCGCCTCTGCGATGGTGG + Intergenic
1109538211 13:63741870-63741892 GCCTCCCGCCTCTGCGATGGGGG + Intergenic
1113820742 13:113210208-113210230 GGCTCCCGGCCCTGCAGTGGAGG - Intronic
1118809100 14:69260750-69260772 CTCTCCCGGCTCTGCGCTGCCGG + Intronic
1121010644 14:90518207-90518229 TTCTGCGCGCTCTGCGGTGCTGG - Intergenic
1122779356 14:104137156-104137178 GTCTGCCGGCAGTGCGGGGTGGG + Intergenic
1123697872 15:22892031-22892053 GTCCCCGGGCTCTGCGGTGGGGG - Intronic
1129689542 15:77705512-77705534 CTCTGCCAGCTGGGCGGTGGGGG - Intronic
1131558593 15:93420123-93420145 GTCTGGCTGCTCTGCTGTGTAGG - Intergenic
1132729631 16:1355054-1355076 GTCTGCCGCGTCTGCGGGGTCGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1134552786 16:15145770-15145792 GTCTGCGGGCACAGCGGCGGGGG - Intergenic
1136066145 16:27760184-27760206 TTCTGCCTGCTCTGTGGTGCTGG + Intronic
1136381735 16:29899247-29899269 TTCTCGCGGCTCTGTGGTGGAGG + Exonic
1138579440 16:57930844-57930866 GGCTGCCGGGGCTGGGGTGGGGG + Intronic
1139484936 16:67250014-67250036 TTGTGCTGGCTCTGCTGTGGGGG + Intronic
1140323022 16:73972220-73972242 CTCTGCTGGCTCTGGGGTGGGGG + Intergenic
1141147180 16:81539389-81539411 GTCTGCAGGCCCTGCGGGGATGG + Intronic
1141330017 16:83102395-83102417 ATCTGCAGGCTCTGAAGTGGGGG + Intronic
1141691962 16:85601561-85601583 GTCTGCCGGCCCCGCGCTGAAGG - Intergenic
1141742373 16:85902406-85902428 GTCTCCCAGCTGAGCGGTGGCGG + Intronic
1145875594 17:28316766-28316788 GGCTGCCGGCTCTGTGGTCCTGG + Intergenic
1146175451 17:30663443-30663465 GTCTGCCAGCTCTGCTCTAGTGG - Intergenic
1146348902 17:32079489-32079511 GTCTGCCAGCTCTGCTCTAGTGG - Intergenic
1146617441 17:34368081-34368103 GTCTGCCGACTGTGCTGTGCAGG - Intergenic
1152530865 17:80918322-80918344 GACTCCAGGCTCTGGGGTGGCGG + Intronic
1160691287 19:461569-461591 GAGTGCCGGCTCGGGGGTGGGGG + Intergenic
1163125653 19:15243013-15243035 GGCTGCTGGCCCTGGGGTGGCGG + Exonic
1166121363 19:40689583-40689605 GTCTGCAGTGTCTGCGGTGACGG - Intronic
1168238265 19:55076642-55076664 GCCTGTCTGCTCTGCAGTGGGGG - Intronic
925225981 2:2184698-2184720 ATCTGCCGGCTCTGCTGGAGAGG - Intronic
925265802 2:2565622-2565644 GTCTGCACACTCTGCTGTGGAGG + Intergenic
927558028 2:24049728-24049750 CTCCTCCGGCTCTGCAGTGGCGG + Exonic
928099965 2:28431226-28431248 GAGTGCTGGCTCTGGGGTGGTGG - Intergenic
928259595 2:29754986-29755008 TCCTGCCGGCTCTGGGGTGGGGG - Intronic
930837448 2:55809264-55809286 GTTTTCTGGCTCTGGGGTGGAGG + Intergenic
932619868 2:73259030-73259052 GTCCGCAGGCTCTGCGACGGAGG - Exonic
936156735 2:110051801-110051823 GTCTCCCGGCTCTCAGATGGAGG + Intergenic
936187957 2:110319643-110319665 GTCTCCCGGCTCTCAGATGGAGG - Intergenic
938474037 2:131591138-131591160 GTCTGACGGTTATGCGGGGGCGG - Intergenic
946310558 2:218880617-218880639 GGCTCCCGGCGCTGCGCTGGAGG + Exonic
948958842 2:241316079-241316101 GTCGGCTGGCTCTGGGGTGCCGG + Intronic
1168848634 20:961677-961699 CCCTGCCGGCTCTGATGTGGGGG + Intronic
1168947942 20:1777179-1777201 GTGGGCCGGCTGGGCGGTGGGGG - Intergenic
1170065606 20:12306783-12306805 TTCTGCCTGCTCTGCTGTGAGGG - Intergenic
1170833434 20:19862932-19862954 GTCTGCTGGCTCCACGCTGGAGG - Intergenic
1172584530 20:36073469-36073491 GTCTGCCAGGTCTGCTGTAGTGG + Intergenic
1172584961 20:36076731-36076753 TTCTGCAGGCGCTGCGGTGGCGG + Intergenic
1173246288 20:41340105-41340127 GTCTGCAGGCACTGCGGGAGGGG - Intergenic
1173586750 20:44188007-44188029 GTCTGCTGGGTCTGCGGCAGGGG - Intergenic
1177669583 21:24208665-24208687 GACTGCCGGCGCTGCAGTGCAGG - Intergenic
1180964107 22:19776731-19776753 GTGTGCTGGCTCTGAGTTGGTGG - Intronic
1182867601 22:33617782-33617804 GTCTGCAGGCTCTGCTGGAGAGG - Intronic
1183195183 22:36348849-36348871 GTCTGAGGGCTCCGAGGTGGGGG - Intronic
1183346971 22:37313317-37313339 GTCAGCCTGCTCTGCCGCGGGGG - Intronic
1183536456 22:38404371-38404393 GGCTTTCGGCTCTGGGGTGGGGG - Intergenic
1184099726 22:42335801-42335823 GGGTGCCAGCTCTGGGGTGGGGG + Intronic
1184551848 22:45208921-45208943 TGCTGCTGGCTCTGCGCTGGTGG - Intronic
957865020 3:86012449-86012471 GTCGGCCGGCTCTGCAGGGCCGG - Intronic
960602132 3:119469011-119469033 GTCTGCCGGCGATGGAGTGGTGG + Exonic
961453151 3:127011621-127011643 GGCTGCAGGCTCTGCGCTGGGGG - Intronic
961530391 3:127536898-127536920 GTCTGGCGGGGCTGTGGTGGGGG - Intergenic
965024180 3:163277529-163277551 TTGTGCAGGCTCTGCGGTGTAGG - Intergenic
966421391 3:179738134-179738156 CTCTGCAGCCTTTGCGGTGGAGG - Intronic
966882364 3:184357650-184357672 GGCTGCCGCCTGTGCCGTGGGGG - Exonic
968625069 4:1623339-1623361 CTCTCCCGGGGCTGCGGTGGGGG - Intronic
969575155 4:8032419-8032441 GTCTGCCAGCCCTGCGGATGTGG - Intronic
969641430 4:8401439-8401461 GGCTGCCAGCTCTGCTGTGCTGG + Intronic
972128483 4:35800891-35800913 TTCTGCCTGCTCTGTGGTGTGGG - Intergenic
975348227 4:73318573-73318595 TTCTGCCTGCTCTGCGGAGCTGG + Intergenic
976199029 4:82561586-82561608 GGCTGGCGGCACTGCGGCGGCGG + Intronic
976270184 4:83222530-83222552 TTCAGCGGGCTCTGGGGTGGAGG - Intergenic
980102130 4:128552264-128552286 TTCTGCCGGCTCTGGGGGGCAGG + Intergenic
984680915 4:182608626-182608648 GTCTGCAGGGTCCGCGGCGGCGG + Intronic
984778501 4:183504609-183504631 GTCTGCCGGCTCTGGGCTAGCGG - Intergenic
985720500 5:1486267-1486289 GGGTGCCGCCTCTGAGGTGGGGG - Intronic
985773936 5:1830768-1830790 CTCTGCCGGCACTGGGGAGGAGG - Intergenic
992093364 5:73339053-73339075 GTCTGTCAGCTGTGTGGTGGAGG + Intergenic
992886252 5:81162974-81162996 GGCTGCTGTCTCTGTGGTGGGGG + Intronic
997736439 5:136215929-136215951 TGCTGCCAGCTCTGAGGTGGTGG + Intronic
1000521509 5:162300113-162300135 GTGTGGGGACTCTGCGGTGGGGG + Intergenic
1003571347 6:7258462-7258484 CTCTGGCGGCTCTGGGGTGGTGG + Intergenic
1004179689 6:13370451-13370473 GTCTGCTGGCTCTGCGTTTTGGG - Intronic
1010204405 6:73309774-73309796 GCCGGCGGGCTCTGCGGTGGCGG - Exonic
1016571349 6:145516542-145516564 GTCTCACGGCTCTGCTGTGGTGG - Intronic
1017672364 6:156779108-156779130 GGCCGCCGGCTCGGCGGCGGGGG + Exonic
1019206828 6:170368808-170368830 GTCTGCCGGGGCTGGGGGGGGGG + Intronic
1019506589 7:1394517-1394539 GTCTGCAGGCTCGGCTGGGGAGG + Intergenic
1019610801 7:1935813-1935835 GTCTGCAGGCTCATCTGTGGTGG - Intronic
1022969919 7:35507524-35507546 GGCTGCTGGCTCTGAGATGGAGG - Intergenic
1029238804 7:99144050-99144072 GGCGTCCGGCTCTGAGGTGGTGG - Exonic
1029482191 7:100819918-100819940 GCCGACCTGCTCTGCGGTGGTGG + Intronic
1032074855 7:128831468-128831490 GTCTGCGGGCTCTGGGGCCGAGG + Intronic
1037859976 8:22398275-22398297 AGCTGCAGGCTCTGGGGTGGCGG - Intronic
1042809675 8:72810407-72810429 TCCTGCAGGCTCTGCTGTGGTGG + Intronic
1044734795 8:95268737-95268759 GACTGCGGGCTCTGCGGGCGGGG + Intronic
1049470386 8:142772714-142772736 TTCTGCCGGCGCTGCTGTGCCGG + Intronic
1049963832 9:760966-760988 GTCTGCCATCTGTGAGGTGGAGG + Intergenic
1056246123 9:84697194-84697216 GTCTGCAGGCTGGGGGGTGGAGG + Intronic
1056972889 9:91223120-91223142 GGCTGGCGGGCCTGCGGTGGAGG + Intronic
1060410124 9:123394733-123394755 GGCTTCAGGCTCTGCGGTGGAGG + Intronic
1061382311 9:130265841-130265863 GGCTGCGGGTGCTGCGGTGGAGG - Intergenic
1061541532 9:131280144-131280166 GTTTGCCGGCTTTGAGCTGGGGG + Intergenic
1061766248 9:132883279-132883301 GTCTGCCTGCTCTGGGCTGGGGG - Intronic
1061873475 9:133532759-133532781 GTCTGCAGGCTCTGGGGTAAGGG + Intronic
1200128765 X:153830212-153830234 GGCCGCCGGCGCTGCGGCGGGGG - Intronic
1200151318 X:153952754-153952776 GTCTGCCGGCTCTGCGGTGGTGG - Exonic
1202161468 Y:21940127-21940149 GTCTGGAGGCTCTGCGGGAGAGG + Intergenic
1202229888 Y:22646246-22646268 GTCTGGAGGCTCTGCGGGAGAGG - Intergenic
1202313268 Y:23549919-23549941 GTCTGGAGGCTCTGCGGGAGAGG + Intergenic
1202557534 Y:26120675-26120697 GTCTGGAGGCTCTGCGGGAGAGG - Intergenic