ID: 1200152765

View in Genome Browser
Species Human (GRCh38)
Location X:153959364-153959386
Sequence CCTCCCTTCCCGCCGGAGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 113}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200152765_1200152772 6 Left 1200152765 X:153959364-153959386 CCGCACTCCGGCGGGAAGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 113
Right 1200152772 X:153959393-153959415 TGACAGGGGCTTTCCCAGCCTGG 0: 1
1: 0
2: 2
3: 30
4: 278
1200152765_1200152773 10 Left 1200152765 X:153959364-153959386 CCGCACTCCGGCGGGAAGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 113
Right 1200152773 X:153959397-153959419 AGGGGCTTTCCCAGCCTGGCTGG 0: 1
1: 1
2: 2
3: 41
4: 297
1200152765_1200152771 -8 Left 1200152765 X:153959364-153959386 CCGCACTCCGGCGGGAAGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 113
Right 1200152771 X:153959379-153959401 AAGGGAGGTCACGGTGACAGGGG 0: 1
1: 0
2: 0
3: 16
4: 176
1200152765_1200152774 14 Left 1200152765 X:153959364-153959386 CCGCACTCCGGCGGGAAGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 113
Right 1200152774 X:153959401-153959423 GCTTTCCCAGCCTGGCTGGCAGG 0: 1
1: 1
2: 3
3: 51
4: 478
1200152765_1200152769 -10 Left 1200152765 X:153959364-153959386 CCGCACTCCGGCGGGAAGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 113
Right 1200152769 X:153959377-153959399 GGAAGGGAGGTCACGGTGACAGG 0: 1
1: 0
2: 3
3: 19
4: 219
1200152765_1200152770 -9 Left 1200152765 X:153959364-153959386 CCGCACTCCGGCGGGAAGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 113
Right 1200152770 X:153959378-153959400 GAAGGGAGGTCACGGTGACAGGG 0: 1
1: 0
2: 3
3: 8
4: 192
1200152765_1200152777 22 Left 1200152765 X:153959364-153959386 CCGCACTCCGGCGGGAAGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 113
Right 1200152777 X:153959409-153959431 AGCCTGGCTGGCAGGTCGCATGG 0: 1
1: 0
2: 1
3: 21
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200152765 Original CRISPR CCTCCCTTCCCGCCGGAGTG CGG (reversed) Exonic
900407403 1:2498659-2498681 CCACCCCTCCCGCCTGTGTGGGG - Intronic
900590188 1:3456010-3456032 CCTCCCTTCCAGCAAGACTGGGG - Intronic
903147107 1:21381441-21381463 CTTCCCTTGCAGCCTGAGTGTGG + Intergenic
903673459 1:25050134-25050156 CCTCCCTTCCCACAGGTGTCAGG + Intergenic
905819848 1:40980408-40980430 CCTCCCTTCCCGGCGGCCGGGGG + Intronic
906514976 1:46433575-46433597 GCTCCCTTCCAGCTGGGGTGAGG - Intergenic
911154312 1:94623783-94623805 CCTCCCTTCCCGCCAGAGTTTGG - Intergenic
912971806 1:114290570-114290592 CCTCCCTTCCCCACGGAGTCTGG - Intergenic
913323260 1:117605582-117605604 TCTCCCTGCCCCCAGGAGTGAGG - Intergenic
917837783 1:178954394-178954416 CCTCTCTTCCAGCCTGGGTGGGG + Intergenic
1072139035 10:92573788-92573810 CCGCCCGTCCCGCCGGCCTGGGG - Intronic
1072722785 10:97791198-97791220 CCTCCCTTCCCTTGGGTGTGAGG - Intergenic
1072757606 10:98030986-98031008 CCTCGCTTCCCTCCGGCCTGGGG - Intergenic
1072784582 10:98270909-98270931 CCTCCCTTCCTGCCTAAGTCAGG + Intergenic
1073458083 10:103649840-103649862 CCTCCCTTCCCCCAGGAAGGGGG - Intronic
1074966889 10:118498861-118498883 CCTCCCTTACCACAGGAGGGTGG + Intergenic
1076834697 10:133015100-133015122 CGTCCCTGCCAGCCGCAGTGAGG - Intergenic
1076834710 10:133015155-133015177 CGTCCCTGCCAGCCGCAGTGAGG - Intergenic
1076858632 10:133129316-133129338 CCTCCCTGCCCGGCTGCGTGGGG - Exonic
1077092827 11:787471-787493 CCTGCCTCCCCGCCGGCGTCGGG + Exonic
1079166842 11:18052072-18052094 CGCCCCTTCCCGCCGTAGTTAGG + Intergenic
1083886130 11:65574317-65574339 CCTGCCGTCCCGCCGGGGCGGGG + Intergenic
1084659889 11:70540471-70540493 CCTCCCTGCCCGCGGGAGCCTGG + Intronic
1092084382 12:5743549-5743571 CCTCCCTTCCTCCCAGAGTATGG - Intronic
1092179391 12:6435039-6435061 CCTCCCTCCCCGCCACAGGGAGG + Intergenic
1093418420 12:18947124-18947146 CCTCCCTTCCCCACATAGTGGGG - Intergenic
1096870297 12:54588512-54588534 CCTTCCCTCCCGCCGCAGCGCGG - Exonic
1106234929 13:27853554-27853576 CCTCCCTTCCAGCCAGCGGGAGG + Intergenic
1106392165 13:29345866-29345888 CCTCCCTTCCCCTAGGGGTGGGG + Intronic
1106660182 13:31791312-31791334 CCTCCCTTCCTGCCAGTGTCAGG + Intronic
1117653323 14:57928557-57928579 CCTCCCTTCCCCTGGCAGTGTGG + Intronic
1118438090 14:65789574-65789596 CCTGCCTTCGCCCCAGAGTGAGG - Intergenic
1122500783 14:102197968-102197990 CCTCTCTTCCCTCCTGAGAGGGG - Intronic
1122707171 14:103628845-103628867 CTTCCCTTCCAGCCGGACTGTGG - Intronic
1122986123 14:105212476-105212498 CCTCCCCTCCTCCCTGAGTGAGG - Intronic
1128242899 15:66113492-66113514 CCTCCTTGCCCGCTGCAGTGAGG + Intronic
1129116589 15:73368368-73368390 CGTCCTTTGCCGCCGGCGTGGGG + Exonic
1132638345 16:965093-965115 CCTCCGTTCCCGCCAGCGTTGGG + Intronic
1132813942 16:1817135-1817157 CCTCCCTGCGGGCCGGGGTGTGG - Intronic
1132846310 16:2002469-2002491 CCTCCCTCCCCGAGGGCGTGGGG - Intronic
1136009238 16:27352126-27352148 TCTCCCTTCCCGCAGGGTTGTGG - Intronic
1136401906 16:30023909-30023931 CCTCCCTCCCCGCCAGGGTCTGG + Intronic
1142663394 17:1447066-1447088 CCTCCCTTCCTTCTGGAGTTTGG - Intronic
1147934775 17:44005265-44005287 CCTCCCGCCCAGCCCGAGTGAGG + Intronic
1148780321 17:50117733-50117755 CCTCCCTTCCCGGAGGAGCTGGG + Intronic
1151146151 17:72043264-72043286 CCTCCATTCCCACCACAGTGTGG + Intergenic
1152924585 17:83081141-83081163 CCTCCCTTCTCGGCCGAGCGGGG + Intronic
1156088656 18:33440267-33440289 CTTCCCTTCCCCCGGCAGTGGGG + Intronic
1156463506 18:37334630-37334652 CCTCCACTCCCCCCGGACTGTGG + Intronic
1156473230 18:37390418-37390440 GCTACCCTCCAGCCGGAGTGAGG - Intronic
1160191426 18:76717314-76717336 CCTCCCACCCCCCCGGATTGAGG + Intergenic
1160708276 19:539934-539956 CCTCCCTTCCTGCCAGAGGCTGG + Intronic
1162013583 19:7831693-7831715 TCTCCCTTCCCGCCAGGGGGTGG - Intronic
1162779808 19:13001082-13001104 CCTCCCTCCCAGCTGGGGTGGGG + Intronic
1162799832 19:13104347-13104369 CCTCCCTGCCCTCCAGAGTGGGG - Intergenic
1163720052 19:18894562-18894584 CCTCCTGTCCCGCAGGGGTGGGG + Intronic
1165827296 19:38712657-38712679 CCCACCCTCCCGCGGGAGTGTGG - Intronic
1166340315 19:42133232-42133254 CCTCCGTGCCCGCCAGAGGGCGG + Intronic
1166765746 19:45251496-45251518 CCTCCCCCCCCGCCGGCCTGGGG - Exonic
1167112404 19:47470014-47470036 CCTCCCTTGCCGCCCCACTGTGG - Intronic
1168410261 19:56135509-56135531 CCTCCCTTCCATCCTAAGTGAGG + Intronic
1168528349 19:57106313-57106335 CTTCCCTTCCCGGGCGAGTGCGG - Intergenic
925851629 2:8087753-8087775 ACTCCCTTCCCACCAGAGGGTGG + Intergenic
927971437 2:27308075-27308097 CCTCCCTCCCCGGAGGAGCGTGG + Intronic
947524931 2:230871997-230872019 TCTCCCTTCCCCCTGGAGGGGGG - Intronic
948688404 2:239686189-239686211 CATCCCTTCCCACTGGAATGGGG - Intergenic
1169075189 20:2755842-2755864 CCTTCCTTCCTGCCACAGTGAGG - Intronic
1172272133 20:33660587-33660609 CCTCCCTCCCCGGAGGTGTGAGG + Intronic
1175987521 20:62771349-62771371 CCTCCCTCCCCCGCCGAGTGGGG - Intergenic
1177149328 21:17438868-17438890 CCTCCCTTCCAGATGGATTGAGG + Exonic
1180138791 21:45878270-45878292 CATCCCTGCCCTCCGGGGTGGGG + Intronic
1182288338 22:29260701-29260723 TCACCCATCCTGCCGGAGTGAGG - Exonic
1184172074 22:42765727-42765749 CCTCCCTTCCCCCTGGAGGGAGG + Intergenic
1184246377 22:43237831-43237853 TCTCCCTTCCTGGCAGAGTGTGG + Intronic
1184522979 22:45007046-45007068 CTTCCATTCCCGCCGGAGGGGGG - Intronic
1185189233 22:49423603-49423625 CCTCCCTTCCTGATGTAGTGCGG - Intronic
1185189761 22:49427726-49427748 CCTCTCTTCCTACCGGGGTGGGG + Intronic
950452540 3:13073344-13073366 CCTCCCGTCCATCCGGGGTGCGG + Intergenic
952764655 3:36944259-36944281 CTTCCCTGCCCGCCCGATTGAGG - Intronic
953257658 3:41306196-41306218 CCTCCCTCCCGGGCGGGGTGGGG - Intronic
954758205 3:52854365-52854387 CCTCCCTTCTCCCTGGAGGGTGG - Intronic
956321816 3:68006542-68006564 CCTCCCTTCCCTCATCAGTGGGG + Intronic
964087420 3:152835043-152835065 CCTCGCCTCCCCGCGGAGTGCGG + Exonic
966890176 3:184401604-184401626 CCTCCTTTCCCACCCGAGAGAGG + Intronic
967311149 3:188107487-188107509 CCTACCTTACAGCAGGAGTGGGG - Intergenic
968452192 4:680961-680983 CCGCCCTTCCCGCTGGAGTGTGG - Intronic
969858548 4:10018820-10018842 CCTCCCCTCTCCCCCGAGTGGGG + Intronic
972466843 4:39365964-39365986 TCTCCCTTCCCCCAAGAGTGGGG + Intronic
972583470 4:40415677-40415699 GCTCCCTTCCCGGCCGAGCGCGG - Intergenic
981923996 4:150117630-150117652 CCTCCATCCCCGCTGGAGTCTGG + Intronic
984702717 4:182828432-182828454 CCTCCCTTCCTCCCGGCCTGAGG + Intergenic
985679298 5:1247506-1247528 CCTGCCTTACCACCGGTGTGGGG - Intergenic
1002347541 5:178558191-178558213 CCTGCCTTCCATCAGGAGTGGGG - Intronic
1003356519 6:5378322-5378344 GATTCCTTCCCGCTGGAGTGAGG + Intronic
1004888625 6:20075367-20075389 TCTCCCTTCCCCCAGGAATGGGG - Intergenic
1006102296 6:31693112-31693134 GGGCCCTTCCCGCCGGGGTGTGG - Exonic
1006719283 6:36139614-36139636 CTTTCCTTCCCGCCAGAGTGGGG + Exonic
1006815193 6:36845329-36845351 CCACCCTTCCAGCAGGAATGAGG - Intergenic
1007049775 6:38815379-38815401 CCTCCATTCCCCACTGAGTGGGG - Intronic
1007088558 6:39167638-39167660 CTTCCCTTCCCGCTGCTGTGGGG - Intergenic
1013007738 6:106089597-106089619 CCTCCATTCACGCAGCAGTGGGG - Intronic
1017724847 6:157269675-157269697 CCTGCCTTCCCGGCTGGGTGTGG + Intergenic
1019358268 7:592195-592217 CCCACCGTCCCGCCCGAGTGAGG + Intronic
1019544592 7:1567600-1567622 CCTCCCTCCCCGGTGGAGGGAGG - Exonic
1023943803 7:44787364-44787386 ACTCCCTTCCCTCCTGAGTGAGG + Intergenic
1027592654 7:80135112-80135134 GCTCCCTCCGCGCCCGAGTGCGG - Exonic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1032013616 7:128361783-128361805 CCTGCCTGCCCGCCCGGGTGTGG - Intergenic
1032100784 7:128975377-128975399 CCTCCCTTCCAGCCACAGAGGGG - Intronic
1033159129 7:138981359-138981381 CCTCCCTCCGCGCCGGTGCGCGG - Intergenic
1034589967 7:152130777-152130799 CCTTCCTTCCTGTCTGAGTGGGG + Intergenic
1047263379 8:123282253-123282275 CCTCCCTTCCCCCTTGAATGAGG - Intergenic
1056235009 9:84585951-84585973 CCTCCCGCCCCGCCCCAGTGTGG - Intergenic
1057566993 9:96173630-96173652 CCTCCCTTTCCCCCAGAGTCTGG + Intergenic
1062440788 9:136568429-136568451 CCTCCCCTCCAGCTGGGGTGGGG - Intergenic
1203789455 EBV:143266-143288 CCCCCATCCCCGCCGGAGCGGGG - Intergenic
1187606988 X:20895713-20895735 CCTCCTTTGCTGCTGGAGTGTGG + Intergenic
1187821982 X:23297561-23297583 CCTCCCTTCCAGCTGGAGAGTGG - Intergenic
1189659964 X:43286272-43286294 CCTCCCTTCTTGGTGGAGTGGGG + Intergenic
1190287812 X:48972210-48972232 CCTCCCTGCCCCCCAGACTGTGG + Intergenic
1198082328 X:133251675-133251697 CCTCCCTTCCAGCTGGTCTGAGG - Intergenic
1200152765 X:153959364-153959386 CCTCCCTTCCCGCCGGAGTGCGG - Exonic
1200747529 Y:6915736-6915758 CCTCCTATCCAGCAGGAGTGGGG - Intronic
1201147498 Y:11072995-11073017 CCACCCTTCCTCCGGGAGTGTGG - Intergenic