ID: 1200152818

View in Genome Browser
Species Human (GRCh38)
Location X:153959626-153959648
Sequence CCATTTCCACAGGTGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200152810_1200152818 22 Left 1200152810 X:153959581-153959603 CCTGCTTGTGTGGGAGTCTGGCT 0: 1
1: 0
2: 3
3: 17
4: 179
Right 1200152818 X:153959626-153959648 CCATTTCCACAGGTGGGGCCAGG 0: 1
1: 0
2: 1
3: 25
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200152818 Original CRISPR CCATTTCCACAGGTGGGGCC AGG Intronic
900193108 1:1359742-1359764 CCATTTCCTCAGCAGGGTCCTGG + Intronic
900547236 1:3235819-3235841 CCCTTTCCAAATGAGGGGCCTGG - Intronic
900709959 1:4107487-4107509 TCATTTCAGCAGGTGGTGCCCGG - Intergenic
901204923 1:7489150-7489172 CCTTTGCCACAGGTGGGCCCTGG + Intronic
901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG + Intronic
901743174 1:11355691-11355713 CCACTCCCACAGATGGGGGCTGG - Intergenic
901756747 1:11446028-11446050 CCTTTTGCACAGGTGGGCACAGG + Intergenic
902178335 1:14668529-14668551 CCCTTTCCCCAGGTGGGCTCTGG - Intronic
902394798 1:16126733-16126755 GCAGTTCCGCAGGTGGGGCAAGG + Intronic
903867859 1:26411630-26411652 CCATATCCACGGGTGGGCTCCGG + Intronic
904869581 1:33608115-33608137 GCATTTCCAAAGATGGGGGCTGG + Intronic
906200799 1:43958937-43958959 ACATTCCCACAGGTGGGGGTTGG - Intronic
906210453 1:44009954-44009976 CCATGTTCAAAGGTGAGGCCTGG - Exonic
907048622 1:51315116-51315138 AAGTTTCCACAGGTGGGGCTGGG - Intronic
908102808 1:60808718-60808740 CTAAATCCACAGGTGGGGCAAGG + Intergenic
908156490 1:61358792-61358814 CTATCTCCACAGGTGGTGGCTGG - Intronic
912386007 1:109271516-109271538 CCTTCTCCACAGGCTGGGCCAGG - Intronic
912861287 1:113216232-113216254 CCAATGCCGGAGGTGGGGCCTGG - Intergenic
912878522 1:113386831-113386853 CCAGTGTCAGAGGTGGGGCCTGG + Intergenic
916437088 1:164787381-164787403 AAACTTCCACAGGTGGGGGCAGG - Intronic
917034299 1:170730092-170730114 CCATTTCCAGAGGGAGGGCTGGG + Intronic
917538835 1:175894275-175894297 CCTTTCCCACAGGGGTGGCCAGG - Intergenic
917784733 1:178442134-178442156 CCAGTGCTAGAGGTGGGGCCTGG - Intronic
917966059 1:180179338-180179360 CCATTTCCTCCGGTGGGGCTAGG - Intronic
918235170 1:182573166-182573188 CCATTTCCTCACTTGGTGCCTGG - Intergenic
920048356 1:203148313-203148335 CCATCTCCACAGGTGAGACTGGG - Intronic
923911699 1:238453852-238453874 CACTTGCCAAAGGTGGGGCCAGG + Intergenic
924052623 1:240093079-240093101 CCATTTCCCGAGGCCGGGCCGGG + Exonic
1063470047 10:6277148-6277170 CCAGTGCTGCAGGTGGGGCCTGG + Intergenic
1063867367 10:10380388-10380410 CCAATACTAGAGGTGGGGCCTGG - Intergenic
1064913836 10:20434637-20434659 CCAGTTCTGGAGGTGGGGCCTGG + Intergenic
1067012401 10:42726798-42726820 CCATTGCTGGAGGTGGGGCCTGG + Intergenic
1068921185 10:62486073-62486095 CCAGTTCTGGAGGTGGGGCCTGG + Intronic
1070083147 10:73208058-73208080 CCAATGCTAGAGGTGGGGCCTGG + Intronic
1071702560 10:87955713-87955735 CCAGTGCTAGAGGTGGGGCCTGG - Intronic
1073338334 10:102727146-102727168 CCAGTTCTACAGGTGGGACCTGG + Exonic
1073980003 10:109143504-109143526 CCAATTCTGGAGGTGGGGCCAGG + Intergenic
1074266208 10:111906067-111906089 CCATTGCTGGAGGTGGGGCCTGG - Intergenic
1075390323 10:122086769-122086791 CCTTTTCTCCAGGTGTGGCCAGG - Exonic
1075765361 10:124888399-124888421 CCATTTCCACTCCTGGGCCCTGG - Intergenic
1075856550 10:125634971-125634993 ACATTTCCTCAGCTGGGGCCAGG + Intronic
1075954364 10:126509100-126509122 CCATTTCATTAAGTGGGGCCTGG + Intronic
1077994703 11:7443162-7443184 CCACTTCCAAAGGGGAGGCCAGG - Intronic
1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG + Intronic
1083024726 11:59540823-59540845 CCAATGCTAGAGGTGGGGCCTGG + Intergenic
1083403471 11:62440656-62440678 CCATTTGGTCAGGTGTGGCCAGG - Intronic
1083922831 11:65789722-65789744 CCATTTCCAGTGGAGGGCCCAGG + Intronic
1084608984 11:70188807-70188829 GCATTTCCACAGATGGTGTCAGG + Exonic
1084809678 11:71604557-71604579 CCATCTCCACAGGTGAACCCTGG + Intergenic
1085297007 11:75437038-75437060 CCATCTCTGCAGGTGGCGCCTGG - Exonic
1085508437 11:77073265-77073287 CCACCTCCACAAGTGTGGCCAGG + Intronic
1087709591 11:101533497-101533519 CCAATTCTAGAGGTGGGGCCTGG - Intronic
1088535997 11:110862126-110862148 CTATTTACAAAGGTGTGGCCAGG + Intergenic
1089412558 11:118258654-118258676 GCATTGCTAGAGGTGGGGCCTGG + Intronic
1089582169 11:119488415-119488437 CCACCTCCAGAGTTGGGGCCAGG - Intergenic
1089792635 11:120955748-120955770 TCATTGGCTCAGGTGGGGCCTGG - Intronic
1090253156 11:125264862-125264884 CCCATTTCACAGATGGGGCCAGG - Intronic
1091353829 11:134919855-134919877 CCATTTCCAAAATTGGGGCTGGG - Intergenic
1093913152 12:24769819-24769841 CCATTTCAGCAGGTGGGGCTTGG + Intergenic
1095925083 12:47570304-47570326 CCTTTTCCACAGGGAGTGCCTGG - Intergenic
1096136793 12:49209361-49209383 CCAGTGCCAGAGGTGGGGCTTGG - Intronic
1097711879 12:62926026-62926048 CCATTTTCAGGGGTGGGTCCTGG + Intronic
1099033834 12:77560714-77560736 CAGTTTCCACAGAGGGGGCCAGG - Intergenic
1101673477 12:106897587-106897609 CCTTTCCCAGAGGTGGAGCCTGG + Intergenic
1101907570 12:108839237-108839259 CCATCTCATGAGGTGGGGCCTGG + Intronic
1102783953 12:115588710-115588732 CCATTTCCACACAGTGGGCCTGG + Intergenic
1103844565 12:123892459-123892481 CCAGTGTTACAGGTGGGGCCCGG - Intronic
1104468792 12:129011688-129011710 TCATTACCACAGGTGGGGTCTGG - Intergenic
1105356575 13:19664713-19664735 CCATTTCCTAAGTTGGGGCACGG + Intronic
1105745649 13:23375259-23375281 TGCTTTCCACAGGTGGGTCCCGG - Exonic
1106134578 13:26964544-26964566 CCAATTCCACATGTATGGCCTGG - Intergenic
1108451940 13:50575876-50575898 CCCTTTCCAAAGGAGGGACCAGG - Intronic
1110334234 13:74308151-74308173 CCATTTTCACAGGTGTGGATGGG + Intergenic
1111817259 13:93169396-93169418 CCATTGCTGGAGGTGGGGCCTGG + Intergenic
1112305848 13:98272912-98272934 CCATTAACACAAGTGTGGCCAGG - Intronic
1112852397 13:103722833-103722855 CCAATGTTACAGGTGGGGCCTGG + Intergenic
1113113518 13:106850053-106850075 CCACTGCCAGAGGTAGGGCCTGG + Intergenic
1113507542 13:110827464-110827486 CCAATACCAGAGGTGTGGCCTGG + Intergenic
1113610623 13:111642398-111642420 CCCTTTCCTCAGGTGGAGCTGGG + Intronic
1114188650 14:20423553-20423575 CCAGTGTCAGAGGTGGGGCCTGG - Intergenic
1114190701 14:20437650-20437672 CCATTTCCCCATTTGTGGCCTGG + Intergenic
1115715325 14:36097237-36097259 CCGATTCTAGAGGTGGGGCCTGG - Intergenic
1116946338 14:50838706-50838728 CTATTTCCAAAGGTGTGGACTGG - Intergenic
1118663926 14:68046011-68046033 CAATTTCCCTAGGTGGAGCCAGG - Intronic
1120321146 14:82962596-82962618 CCATTTCTAGAGGTGGTTCCTGG + Intergenic
1121140932 14:91540955-91540977 CCATTGCTGGAGGTGGGGCCTGG - Intergenic
1121581716 14:95037003-95037025 CCCTTTCCACAAGTGAGGCTGGG - Intergenic
1124252711 15:28117447-28117469 CCACGTCCACAGCTGCGGCCCGG + Intronic
1124645763 15:31436666-31436688 CCATTCACAGAGGTGTGGCCTGG + Intergenic
1125318757 15:38459541-38459563 CTAATTCCACAGGTGCGGGCTGG + Intronic
1126672542 15:51129454-51129476 CCACTTCCTCAGGTGTGCCCTGG - Intergenic
1127642770 15:60931181-60931203 CCAGGTCCATAAGTGGGGCCAGG + Intronic
1127963413 15:63906862-63906884 CCATTTCCACCGAAGGGGCCAGG + Intergenic
1129762686 15:78139889-78139911 CCAATGCTAGAGGTGGGGCCTGG - Intronic
1130992838 15:88886875-88886897 CCCTTTCCACTGGGGGGACCAGG + Intronic
1131373649 15:91905567-91905589 CCATTTCCACAGGTCCATCCAGG - Intronic
1131554152 15:93382357-93382379 TAATTTCCACAGGTGGGACAAGG + Intergenic
1132070822 15:98775394-98775416 CCATTTCCAGGGGTGGGACTGGG + Intronic
1132495753 16:262542-262564 GCTTTCCCACAGGTGGGTCCGGG + Exonic
1132543365 16:521705-521727 GCTTCTCCACAGGTGCGGCCTGG + Exonic
1132615694 16:840254-840276 CCGTGTCCCCAGGTGGGGCGCGG + Intergenic
1132678560 16:1130629-1130651 ACACATCCACAGGTGGGCCCAGG - Intergenic
1132694838 16:1197354-1197376 ACGCTTCAACAGGTGGGGCCAGG - Intronic
1133304148 16:4799530-4799552 CCATTTCTACCTGTGGGGTCAGG - Intronic
1133837341 16:9378684-9378706 GCGGTTCCCCAGGTGGGGCCAGG - Intergenic
1135975012 16:27102972-27102994 CCATATGCACACGTGTGGCCGGG + Intergenic
1138768372 16:59631742-59631764 CCATTTACAAAAGTGGGGCAAGG + Intergenic
1138789075 16:59881247-59881269 CCATTTCCAAAGATGTGGGCAGG + Intergenic
1139949719 16:70663084-70663106 CCCTTCCCACACGGGGGGCCTGG + Exonic
1143032761 17:3976915-3976937 CCAGGTCCTCAGATGGGGCCCGG + Intergenic
1143365071 17:6402114-6402136 CCATTGTTAGAGGTGGGGCCTGG - Intronic
1143936018 17:10484896-10484918 CCAGTGTCAGAGGTGGGGCCTGG - Intergenic
1146732445 17:35205542-35205564 CCATTGTTAAAGGTGGGGCCTGG + Intergenic
1148514866 17:48207192-48207214 CCACTTGCACAGGTTGGGCATGG + Intronic
1149655629 17:58308420-58308442 CCATCAGCAGAGGTGGGGCCGGG - Intronic
1150739660 17:67769192-67769214 CCAGTGTCAGAGGTGGGGCCTGG + Intergenic
1151450306 17:74194702-74194724 CCCTCAGCACAGGTGGGGCCTGG - Intergenic
1154346703 18:13548683-13548705 CCATGTCCACAGCTGTGGCTGGG + Intronic
1157621823 18:49021264-49021286 CCACTGCCACAGCTGGGCCCTGG + Intergenic
1157931242 18:51825865-51825887 CCAATGTCAGAGGTGGGGCCAGG - Intergenic
1158998069 18:62943731-62943753 CCAGTGTCAGAGGTGGGGCCCGG - Intronic
1159036909 18:63286286-63286308 CCTTTTACACAGTTGGGGGCAGG + Intronic
1159372344 18:67544714-67544736 CCAGTTTCAGAGGTGGGGTCAGG - Intergenic
1160342272 18:78099882-78099904 CCATCTCCACGGGTGGGTGCAGG + Intergenic
1160354501 18:78215769-78215791 CCATCTCCACTGGCGGGTCCTGG - Intergenic
1160764035 19:799146-799168 CCTGGTCCAGAGGTGGGGCCTGG + Intronic
1161629778 19:5347716-5347738 TCTTTTCAACAAGTGGGGCCAGG + Intergenic
1165114384 19:33520465-33520487 CCATTTGCAAAGGAGGGGCATGG - Intronic
1165433548 19:35785086-35785108 ACCTTTCCGCAGGTGAGGCCGGG - Exonic
1166407140 19:42529214-42529236 CCTTCCCCACAGGTGGTGCCAGG + Intronic
1168384021 19:55947999-55948021 CCATTTTCACATGGGGAGCCGGG - Exonic
925459148 2:4044781-4044803 GCATTTACACAGGTGAGGACAGG - Intergenic
925859487 2:8161068-8161090 TCATTCACACAGGTGGGGGCTGG - Intergenic
925982841 2:9191161-9191183 CCGTTTCCACAGGTCTGGCCCGG + Intergenic
927355383 2:22167252-22167274 CCATGTTCAAGGGTGGGGCCAGG - Intergenic
932365943 2:71153681-71153703 CGACTTGCACAGGTGGGGGCTGG + Intergenic
932489845 2:72113723-72113745 CCATTGCCTCTGATGGGGCCAGG - Intergenic
933170897 2:79123432-79123454 CTATTTCCACAGCTGATGCCTGG + Intergenic
935360853 2:102245325-102245347 CCTCTTCCTCAGGTGGGGGCTGG - Intergenic
935881645 2:107571378-107571400 CCATTTCTACAAGTGTGCCCCGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937225651 2:120367341-120367363 CCATTTGCTCAGGTAGGGCATGG - Intergenic
937465848 2:122132385-122132407 CCATTACTAGAGGTGTGGCCTGG - Intergenic
937495345 2:122413425-122413447 CCAAGTCCACATGTGGGGCTAGG - Intergenic
938170170 2:129069191-129069213 CGATTCCCACAGATGGGGCAGGG + Intergenic
939167374 2:138654054-138654076 CCAGTGCCGGAGGTGGGGCCTGG - Intergenic
939485140 2:142801942-142801964 CCAGTTTTAGAGGTGGGGCCTGG - Intergenic
940222407 2:151366118-151366140 CCAAATCCACAGTTGGGCCCTGG - Exonic
942603734 2:177668033-177668055 CCATCTCCTCAGGGGAGGCCTGG - Intronic
943016980 2:182525487-182525509 CCAGTTCTAGAGGTGGGGCCTGG + Intergenic
944443871 2:199769808-199769830 TCATTTACACAGGTGTTGCCAGG - Intronic
946724482 2:222648494-222648516 CCATTTCCACAGCATGAGCCTGG + Intronic
946806894 2:223479797-223479819 CCATTTCCAGAAGTATGGCCTGG + Intergenic
946825456 2:223673029-223673051 CCATTGCTGGAGGTGGGGCCTGG - Intergenic
947805800 2:232967047-232967069 CCAATGCCTGAGGTGGGGCCTGG + Intronic
948405484 2:237715277-237715299 CCATTTCTACACTTGGGCCCTGG - Intronic
948668735 2:239552744-239552766 CCAGTGCTGCAGGTGGGGCCTGG + Intergenic
1169221591 20:3826313-3826335 ACATTTCCACTGGTGGGACTTGG - Exonic
1170719213 20:18860406-18860428 CCAATTTTGCAGGTGGGGCCAGG + Intergenic
1171054794 20:21895818-21895840 CCAATTCTAGAGGTGGGACCTGG - Intergenic
1171139462 20:22728641-22728663 CAATTTGGACAGATGGGGCCTGG - Intergenic
1171815365 20:29781615-29781637 CCAATGCCAAACGTGGGGCCTGG - Intergenic
1171903011 20:30874419-30874441 CCAGTGCCAAACGTGGGGCCTGG + Intergenic
1173311954 20:41904650-41904672 CCATTTGCAAAGGTGGGGGCAGG - Intergenic
1175197375 20:57253619-57253641 CCATTTCCAAGGCTGGGGGCAGG - Intronic
1175942623 20:62544915-62544937 CCAGTGCCGGAGGTGGGGCCTGG - Intergenic
1177722802 21:24928920-24928942 CCAATTTCAGAGGTGGGGCCTGG + Intergenic
1179190586 21:39118896-39118918 CCATTTCCCTGGGTAGGGCCGGG - Intergenic
1179677045 21:42990319-42990341 CCATGTTCACAGCTGGGGTCTGG + Intronic
1180155511 21:45975400-45975422 AAATTTCCCCAGCTGGGGCCTGG + Intergenic
1180336407 22:11580390-11580412 CCAATGCCAAACGTGGGGCCTGG + Intergenic
1181050055 22:20234191-20234213 CCAGGCCCAGAGGTGGGGCCAGG + Intergenic
1181671780 22:24428841-24428863 CCATATGCTCAGATGGGGCCAGG + Intronic
1182189748 22:28446436-28446458 CCAATGTCAGAGGTGGGGCCTGG + Intronic
1183309219 22:37100426-37100448 CCTCTGCCACAGCTGGGGCCAGG - Intronic
1183341522 22:37284376-37284398 CCATTTGCACAGCTGGGTCAGGG - Intronic
1184132050 22:42522659-42522681 CCAGTGCTAGAGGTGGGGCCTGG + Intergenic
1184450029 22:44577287-44577309 CCATTTCCTCTGCTGGGTCCTGG + Intergenic
1184641112 22:45870731-45870753 CAAGTTCCAGAGGTGGGGCTGGG + Intergenic
1185329277 22:50244950-50244972 CACTTTCCACGGGTGAGGCCTGG - Intronic
949515459 3:4803235-4803257 CCAGTGTCAGAGGTGGGGCCTGG - Intronic
950465859 3:13153314-13153336 CCACTTCCACAGGACGGGCTTGG - Intergenic
950581672 3:13866352-13866374 CCATTCCCACAGGTGGCGAGAGG - Intronic
950955909 3:17053421-17053443 CCAGTGCTAGAGGTGGGGCCTGG - Intronic
953386251 3:42507610-42507632 CCAGTTCCCTAGGTGTGGCCAGG + Intronic
953666418 3:44929262-44929284 CCATTTCCACACCTGGGGATGGG - Intronic
954028842 3:47803557-47803579 CCGTTTCCCCAGGCAGGGCCTGG + Intronic
955216050 3:56985825-56985847 ACATACCCACAGGTGGGGCTGGG + Intronic
955409649 3:58647365-58647387 CCAATCCCATAGGTGGGGGCTGG - Intronic
955518608 3:59752608-59752630 CCAGTGTCAGAGGTGGGGCCTGG + Intronic
958101692 3:89019934-89019956 CCAATGTCAGAGGTGGGGCCTGG + Intergenic
958540200 3:95461330-95461352 CCATTGTTGCAGGTGGGGCCTGG - Intergenic
961289158 3:125831556-125831578 CCAGTTTTAGAGGTGGGGCCTGG - Intergenic
961477882 3:127159834-127159856 CCACTTCCCCAGGTGGTGTCAGG - Intergenic
962278959 3:134036046-134036068 GCATTTTCTCAGGTGGGGGCAGG - Intronic
966097993 3:176229038-176229060 CCATTGCTGGAGGTGGGGCCTGG + Intergenic
966916286 3:184585828-184585850 CCATTTCCCCAAGCGGGCCCAGG - Intronic
967879388 3:194288548-194288570 CCAGTGCTGCAGGTGGGGCCTGG - Intergenic
968148966 3:196322092-196322114 CCAGTGCTAGAGGTGGGGCCTGG - Intronic
968528226 4:1075581-1075603 CCAGTGCCCGAGGTGGGGCCTGG - Intronic
969512997 4:7630224-7630246 CCATGTCCACAGGTGAGGCTGGG + Intronic
969745557 4:9068474-9068496 CCAGTGTTACAGGTGGGGCCTGG - Intergenic
970657874 4:18251503-18251525 CCCTTTCCACTGGTGTTGCCAGG + Intergenic
971245279 4:24921654-24921676 CCATTCCCACATGTGGGCGCTGG - Intronic
971548424 4:27917055-27917077 CCATTTCCCCAAGTGAGGCTTGG + Intergenic
972828590 4:42788421-42788443 CCAGTGTCAGAGGTGGGGCCTGG + Intergenic
973091097 4:46137437-46137459 CCAATGCTAGAGGTGGGGCCTGG + Intergenic
973533820 4:51860779-51860801 TCAGTGCCAGAGGTGGGGCCTGG - Intronic
974205486 4:58697171-58697193 CCAGTGTCACAGGTGGGGTCTGG - Intergenic
976440566 4:85068711-85068733 GCATTTCTCCAGGTAGGGCCTGG - Intergenic
976894473 4:90091828-90091850 CCATTATTAGAGGTGGGGCCTGG - Intergenic
981742547 4:148017874-148017896 TCATTTCCACATGTGGTCCCTGG + Intronic
982251762 4:153414138-153414160 ACATTTCCACAGCAGAGGCCAGG - Intronic
982829747 4:160044588-160044610 CCAGTACAACAGGTGGGGGCAGG - Intergenic
984853963 4:184177162-184177184 CCATTTCCCCTGCTGGTGCCAGG + Intronic
985504603 5:271810-271832 CGTTTTCCAGAGGTGCGGCCTGG + Exonic
985803700 5:2022747-2022769 CCATTCCCACAGTAGGAGCCAGG - Intergenic
985824242 5:2180957-2180979 CCCTTTCTACAGTTGGGGACCGG + Intergenic
986274652 5:6263162-6263184 CCAGTGGCAGAGGTGGGGCCAGG + Intergenic
986726490 5:10601878-10601900 CCATTTCCCCCCATGGGGCCAGG + Intronic
987035250 5:14012807-14012829 GTTTTTCCACAGGTGGGGCAGGG + Intergenic
987213221 5:15706170-15706192 CCAGTGCTGCAGGTGGGGCCTGG + Intronic
987475570 5:18388282-18388304 CCAATGCTAGAGGTGGGGCCTGG - Intergenic
987663184 5:20904257-20904279 CCATTACTGCAGGTGGGACCTGG - Intergenic
988425481 5:31058626-31058648 CCAATTCTAGAGGTGGGGCCTGG + Intergenic
988759503 5:34297928-34297950 CCATTACTGCAGGTGGGACCTGG + Intergenic
990520488 5:56574521-56574543 CCAATGCTAGAGGTGGGGCCTGG - Intronic
990873868 5:60462641-60462663 CCAGCTCAACAGGTGAGGCCAGG + Intronic
994225863 5:97250738-97250760 CCAGTGGCAGAGGTGGGGCCTGG - Intergenic
996473375 5:123886194-123886216 CCATTGCTGGAGGTGGGGCCTGG + Intergenic
996657183 5:125954884-125954906 CCAATTCTGGAGGTGGGGCCTGG - Intergenic
999153915 5:149444393-149444415 CCAGTGTCAGAGGTGGGGCCTGG + Intergenic
999425723 5:151486314-151486336 CCAATGTCAGAGGTGGGGCCTGG - Intronic
999742360 5:154566017-154566039 CCATTTGCACAGCTGGTTCCTGG - Intergenic
1001284261 5:170410920-170410942 TGAATTCCACAGGTGGGGCATGG - Intronic
1002043191 5:176528892-176528914 GCATTTCCAGAGCTGGTGCCAGG - Exonic
1002772206 6:299791-299813 CCCATGCCACAGGTGTGGCCGGG + Intronic
1003629132 6:7770891-7770913 CCATCTCTGTAGGTGGGGCCTGG + Intronic
1006583413 6:35089613-35089635 CCTTTTCCACACCGGGGGCCAGG - Exonic
1006749238 6:36366341-36366363 CCATTTACAGGGGTGGGGCTGGG + Exonic
1007393949 6:41566660-41566682 CTTTTTCCCCAGGTGGGACCAGG - Intronic
1007993832 6:46285288-46285310 CTATTTCCAGAGATGGAGCCTGG + Intronic
1010249346 6:73692150-73692172 CCAATTTCGGAGGTGGGGCCTGG - Intergenic
1010426613 6:75734889-75734911 CCAATGCTATAGGTGGGGCCTGG - Intergenic
1012187068 6:96232030-96232052 CCAGTGCTAGAGGTGGGGCCTGG - Intergenic
1013052447 6:106549392-106549414 TCATGGCCACAGGTGGAGCCAGG + Intronic
1013091238 6:106902529-106902551 CCAATGCTACAGGTGGGTCCTGG + Intergenic
1013328344 6:109070540-109070562 CCATTTCAACTGGTGGGCCCTGG - Intronic
1015286302 6:131489929-131489951 CCAGTGTCAGAGGTGGGGCCTGG - Intergenic
1015748616 6:136537738-136537760 TCATTTCCTCAGATGGGTCCTGG - Intronic
1017073822 6:150600098-150600120 CCACATCCGCAGGTGGGGCCGGG + Intronic
1017719356 6:157234149-157234171 CCATTTCCCCAGGTGTGAGCAGG - Intergenic
1018805066 6:167252852-167252874 CCAATGCCAGAGGTGGGGCCTGG + Intergenic
1018892670 6:167993955-167993977 CAAATTCCACAGGTGAGGGCAGG + Intergenic
1018969678 6:168517734-168517756 CCTTTTCCTCAGCTGGGGCTGGG + Intronic
1019925944 7:4191820-4191842 CCATCTCCACAGGTGTGGCCGGG + Intronic
1020309672 7:6858512-6858534 CCATCTCCACAGGTGAACCCTGG - Intergenic
1021250423 7:18318474-18318496 CCATCTCCACAGGTGACTCCAGG - Intronic
1022332202 7:29390704-29390726 TCAGTTTCACAGGTGGGTCCTGG + Intronic
1022965106 7:35465363-35465385 CCAATTCCAAAGGTGTGGCCAGG + Intergenic
1023098553 7:36689154-36689176 CCATGTCCACAAGTGGAGACTGG - Intronic
1026773594 7:73217452-73217474 CTAGTTCCACAAGTGGGGCCAGG - Intergenic
1027014453 7:74770846-74770868 CTAGTTCCACAAGTGGGGCCAGG - Intergenic
1027073580 7:75175111-75175133 CTAGTTCCACAAGTGGGGCCAGG + Intergenic
1027992077 7:85375447-85375469 CCAATTCTGGAGGTGGGGCCTGG + Intergenic
1028526190 7:91789643-91789665 CCATTTCCACAAATGTGGCATGG + Intronic
1029506678 7:100967226-100967248 CCATTTCAAGAGGTGGCCCCAGG + Exonic
1033197462 7:139340171-139340193 CCATTTCCGCAGGCCGGGCGTGG - Intronic
1033585892 7:142774096-142774118 TCATTTTCCCTGGTGGGGCCTGG - Intergenic
1033843615 7:145404496-145404518 CCATTGCCAGAGGTGGCACCGGG + Intergenic
1037643509 8:20770223-20770245 TCAGTTCCAAAGCTGGGGCCTGG + Intergenic
1037875474 8:22545017-22545039 CCATACCCACAGATGGGCCCTGG - Intronic
1037933804 8:22900773-22900795 TATTTTTCACAGGTGGGGCCAGG - Intronic
1038289644 8:26237360-26237382 CCAGTTTTGCAGGTGGGGCCTGG + Intergenic
1039173937 8:34782074-34782096 CCATTAGCACAGGTGAGGACAGG + Intergenic
1039373851 8:37013767-37013789 CCATTGTTACAAGTGGGGCCTGG - Intergenic
1039433356 8:37543010-37543032 GAATTTCTAGAGGTGGGGCCTGG + Intergenic
1041309140 8:56496532-56496554 AAATTTCCACAGGTAGGCCCAGG + Intergenic
1041778397 8:61550543-61550565 CCCATTCCACAGATGTGGCCTGG - Intronic
1044064953 8:87687945-87687967 CCTTTTCCACAGATGGGGGTTGG + Intergenic
1045547700 8:103142845-103142867 TCACTGCAACAGGTGGGGCCTGG + Intronic
1046343445 8:112889526-112889548 ACATTTCCATAGGTGCTGCCTGG - Intronic
1047095167 8:121617158-121617180 CCATCTCCACAGATGAGGCTGGG + Exonic
1047885818 8:129249066-129249088 CCAATAGTACAGGTGGGGCCTGG + Intergenic
1048500567 8:134971013-134971035 CCAATGCTAGAGGTGGGGCCTGG + Intergenic
1048601847 8:135926854-135926876 CTATTTCCAGAGGTGAGGGCAGG - Intergenic
1050586145 9:7113505-7113527 CCATTTCCATAGGAAGGGCTGGG + Intergenic
1051040861 9:12809191-12809213 CCAATGCTAGAGGTGGGGCCTGG - Intronic
1051920818 9:22261092-22261114 CCAGTGCCGGAGGTGGGGCCTGG + Intergenic
1052660522 9:31423049-31423071 CCATTGCTTTAGGTGGGGCCTGG - Intergenic
1052995569 9:34550159-34550181 ACAGTCCCAGAGGTGGGGCCTGG - Intergenic
1053066881 9:35075285-35075307 CTTTTTCCTCAGGTGTGGCCCGG + Exonic
1055199747 9:73646153-73646175 CCATTTCAACAGCTGGTGCCAGG - Intergenic
1055800619 9:80032179-80032201 CCAGTGTTACAGGTGGGGCCTGG - Intergenic
1056334297 9:85550935-85550957 CCAGTGTCAGAGGTGGGGCCTGG + Intronic
1056397404 9:86194241-86194263 CCAGTATCAGAGGTGGGGCCTGG + Intergenic
1056952771 9:91057844-91057866 CCATTGCTGGAGGTGGGGCCTGG + Intergenic
1059600496 9:115772233-115772255 CCATTTCCTCAGATGGTGTCTGG - Intergenic
1061082902 9:128382936-128382958 CCATGTCTACACTTGGGGCCTGG - Intronic
1061759866 9:132843162-132843184 CCATTGCTAGAGGTGGAGCCTGG + Intronic
1062443188 9:136582644-136582666 CCCGTGTCACAGGTGGGGCCAGG + Intergenic
1062445117 9:136590371-136590393 CCAGTGTCACAGTTGGGGCCCGG + Intergenic
1185722348 X:2392150-2392172 CCATTTCCCCAGGAAGGACCAGG - Intronic
1186317626 X:8387860-8387882 CCAATGTCAGAGGTGGGGCCTGG + Intergenic
1186681631 X:11881083-11881105 CCATTTTCATAGGTGTGGCACGG - Intergenic
1188436015 X:30159446-30159468 TCAGTGCCACATGTGGGGCCTGG - Intergenic
1188500074 X:30815678-30815700 GCATATCCACATCTGGGGCCAGG - Intergenic
1191029953 X:55959046-55959068 CCAGCTGCACTGGTGGGGCCAGG - Intergenic
1192496976 X:71622699-71622721 CCTTGACCACAGGTGGGGCCCGG - Intergenic
1192786735 X:74343650-74343672 CCAATTCTGGAGGTGGGGCCTGG + Intergenic
1195422144 X:104687505-104687527 CCAGTGTCAAAGGTGGGGCCTGG - Intronic
1197715771 X:129705084-129705106 CCAGTTCCACAGTAGGGCCCTGG - Intergenic
1199334885 X:146606942-146606964 CCAATTCTGGAGGTGGGGCCTGG - Intergenic
1200152818 X:153959626-153959648 CCATTTCCACAGGTGGGGCCAGG + Intronic