ID: 1200153789

View in Genome Browser
Species Human (GRCh38)
Location X:153964562-153964584
Sequence ACTCCAGGTAAAGCAGCCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200153789 Original CRISPR ACTCCAGGTAAAGCAGCCCC AGG (reversed) Exonic
900666696 1:3820441-3820463 CCTGTAGGAAAAGCAGCCCCTGG + Intronic
901652964 1:10753582-10753604 ACTTCAGATAAAGCAGGCCAGGG + Intronic
902089704 1:13893306-13893328 ACCCCAGGAGAAGCAGCCCCGGG + Intergenic
902788971 1:18752161-18752183 ACCCCAGGTCAGGGAGCCCCGGG + Intergenic
903142756 1:21349134-21349156 GCTCCAGAAAACGCAGCCCCTGG + Intergenic
904200948 1:28818735-28818757 ACACCTGGTAGAGTAGCCCCAGG + Intronic
907323240 1:53618849-53618871 AATCCAGGGAAAGGACCCCCAGG + Intronic
911419531 1:97622520-97622542 ACTCTAGGTAAAACCGACCCTGG + Intronic
915322028 1:155061483-155061505 ACTCCAGGTAAATCTGGGCCAGG + Exonic
920461462 1:206143897-206143919 ACTCCAGGTCCTGCAGCCCAGGG + Intergenic
922568657 1:226618726-226618748 ACTCCAGGTCCAGCAGGCACAGG - Intergenic
923564725 1:235068280-235068302 ACTTCAGGTAAGTCAGCCCGTGG - Intergenic
1063223082 10:3989288-3989310 CCTCCAGGCAAAGCAGCTCTGGG - Intergenic
1063668502 10:8080996-8081018 ACTCCAGGTAGACCATTCCCAGG + Intergenic
1067796282 10:49324449-49324471 ACTCCAGGGAACACCGCCCCAGG + Exonic
1068040299 10:51815842-51815864 GGTGCAGGGAAAGCAGCCCCTGG + Intronic
1070814475 10:79314114-79314136 ACTCAAGCAAAAGCAGCCTCTGG + Exonic
1071274892 10:84044581-84044603 ACTCCTGGTGAAGCTGCCCATGG - Intergenic
1071579731 10:86757402-86757424 ACAACAGGTGAAGCAGCTCCGGG - Intronic
1072758232 10:98035319-98035341 TCTGCAGGCAGAGCAGCCCCAGG + Intergenic
1073582681 10:104682319-104682341 AGTCCAGGCCATGCAGCCCCAGG - Intronic
1076024561 10:127100931-127100953 TCACCCGGAAAAGCAGCCCCAGG - Intronic
1076729708 10:132432249-132432271 GCCCCAGGAGAAGCAGCCCCGGG + Intergenic
1076756094 10:132572492-132572514 CTCCCAGGGAAAGCAGCCCCGGG - Intronic
1077411104 11:2404314-2404336 ACTGAAGATAAAGCAGCCACTGG + Intergenic
1077496942 11:2891022-2891044 ACCCCAAGGGAAGCAGCCCCTGG - Intronic
1082781692 11:57293117-57293139 GCCCCAGGCAAATCAGCCCCAGG + Intergenic
1082802023 11:57421710-57421732 ACTCCTGGAAAAGAAGACCCTGG + Intronic
1083251885 11:61473722-61473744 GCTGCAGGAAAAGCAGCTCCAGG + Intronic
1084757585 11:71249500-71249522 ACTCCAGGTACAACAGCCCCAGG + Intronic
1085445639 11:76599073-76599095 CTCCCAGGAAAAGCAGCCCCTGG + Intergenic
1087871188 11:103294979-103295001 ACTCCAGGCAATGCAGCACATGG - Intronic
1089124808 11:116169349-116169371 CCTGCAGGAAAAGCAGCCCCAGG + Intergenic
1091104983 11:132910158-132910180 ACTGCAATTAAAGCAGCCGCAGG + Intronic
1096519254 12:52174882-52174904 TCTCCAGGATAAGCAGCCCAGGG - Intronic
1100186655 12:92146221-92146243 ACTCCAGGGCAAGCGGGCCCAGG - Intergenic
1102827484 12:115961648-115961670 ACTGCAGGTAAAGTAGGCACTGG + Intronic
1103570787 12:121843466-121843488 AGTCTCTGTAAAGCAGCCCCAGG + Intronic
1103604130 12:122074452-122074474 ACTCCAGTTAATGCAGCTCTTGG + Intergenic
1105776717 13:23669091-23669113 CCTCCAGGTAAGGCAGCGACTGG + Exonic
1106414492 13:29535030-29535052 ACTGCAGGGAAAGGGGCCCCTGG + Intronic
1108289224 13:48941281-48941303 ACTCCAGGTAAAGGGGGCCAGGG + Intergenic
1108759544 13:53545910-53545932 GCTCCAGGTCCACCAGCCCCAGG - Intergenic
1109554584 13:63955459-63955481 ACTCCAGGCAATGCAGCTCAAGG - Intergenic
1110063259 13:71067931-71067953 ACTCCAGGCAATCCAGACCCAGG - Intergenic
1110642205 13:77838487-77838509 AGTTCCGGTAAACCAGCCCCAGG - Intergenic
1112278724 13:98044411-98044433 GCTCCAGGTAGAGCACTCCCAGG - Intergenic
1115460814 14:33658614-33658636 GCTCCAGGTTAAGGAGTCCCTGG - Intronic
1116916754 14:50532607-50532629 TCTCCCGGTGACGCAGCCCCGGG - Exonic
1118716868 14:68566093-68566115 TCTCCAGGTTAAGCAGCTCCAGG + Intronic
1120932928 14:89866690-89866712 ACTCCAGCTCAATCAGGCCCCGG + Intronic
1122079250 14:99255705-99255727 ACTACAGGTAAAACTGTCCCTGG + Intronic
1122286488 14:100655468-100655490 ACTCCAAGGACAACAGCCCCCGG - Intergenic
1124121629 15:26893655-26893677 ACTCCAGGGTGAGCAGGCCCTGG - Intronic
1125506667 15:40271415-40271437 ACTCCTGGCTAAGGAGCCCCCGG - Intronic
1125734170 15:41911985-41912007 AGTGCAGGTAAAGCAGGCCCTGG - Intronic
1126941355 15:53769518-53769540 TCCACAGGTATAGCAGCCCCAGG + Intergenic
1129665408 15:77576779-77576801 ACTCCAGACCAAGCACCCCCAGG - Intergenic
1130226370 15:82061504-82061526 ACTCCAGGTAAATCATTCCCTGG - Intergenic
1130623666 15:85490894-85490916 ACCCAAGATAAAACAGCCCCTGG - Intronic
1132546020 16:533823-533845 AGTCCCGGGAAATCAGCCCCGGG - Intronic
1132556295 16:574200-574222 CATCCAGGTCAAGCAGCTCCTGG + Exonic
1133050988 16:3117286-3117308 TCTCCAGGGCAAGCAGCCCTCGG - Intronic
1134077808 16:11304314-11304336 CTTCCAGGCACAGCAGCCCCAGG - Intronic
1134311251 16:13077093-13077115 AGTCCAGCTAATGCAGCACCAGG + Intronic
1138158098 16:54724919-54724941 AGTCCAGGAAAAGCATTCCCAGG - Intergenic
1138715889 16:59021629-59021651 AGTCCATGTACAGCAGCCTCTGG + Intergenic
1139659481 16:68411134-68411156 CCTCCAGGCAAAGCAGGCCGGGG + Intronic
1140690613 16:77479946-77479968 TCTCAAGGTAAAGCCTCCCCTGG + Intergenic
1142078362 16:88133373-88133395 CCTCCCTGTCAAGCAGCCCCTGG + Intergenic
1143551902 17:7635480-7635502 ACTCCAGGGTAAGGAGGCCCTGG + Intergenic
1143609715 17:8011020-8011042 ACGCCAAGCAGAGCAGCCCCCGG + Intronic
1144947758 17:18978456-18978478 TCTCCAGGTGAAGCAGTCCTGGG + Exonic
1144954093 17:19010454-19010476 ACTCCAGAGTAAGCAGCCCCGGG - Intronic
1145414574 17:22704103-22704125 ACTTCAGGCTCAGCAGCCCCAGG + Intergenic
1151655822 17:75495537-75495559 TCTCCAGGCCAAGCTGCCCCGGG + Exonic
1155654122 18:28176178-28176200 GCTCCAGGCAAAGGCGCCCCCGG + Intronic
1160519636 18:79497310-79497332 ACTCAAGGAAGAGCGGCCCCAGG + Intronic
1164624073 19:29715109-29715131 CCCCCAGGTAAAGGAGCGCCCGG - Intronic
1165699854 19:37929210-37929232 ACTTCAGGTAAGGCTGGCCCCGG - Intronic
1166541464 19:43608489-43608511 ACTACAGGTAATGCATCACCAGG - Intronic
1167504229 19:49862801-49862823 AGACCAGGCGAAGCAGCCCCAGG - Intronic
1167614788 19:50526434-50526456 GCTCCAGGGAACCCAGCCCCGGG - Intronic
1167642391 19:50688906-50688928 ACTCCAGGTACTGCAGCGCCGGG + Exonic
925099942 2:1235704-1235726 GATCCAGGAAAAGCTGCCCCTGG + Intronic
931575164 2:63711038-63711060 ACGCCAGGTAAAGAACCCCTAGG + Intronic
932892288 2:75607592-75607614 CCTCCAGGTGTGGCAGCCCCAGG + Intergenic
935447127 2:103168448-103168470 ACTGCAGGTAAATCACTCCCTGG - Intergenic
935646249 2:105337641-105337663 ACTCCTGGGACAGCAGCTCCGGG - Exonic
937295938 2:120810028-120810050 ACTCCAGGTGGATGAGCCCCAGG + Intronic
937530556 2:122822350-122822372 GCTCAAGGTAAAGCAGAACCAGG + Intergenic
938042126 2:128084415-128084437 CCTCCAGGTAGAGAAGCCCAAGG - Intergenic
943235866 2:185318802-185318824 ACTCCAGGGAAAGTTGACCCAGG + Intergenic
945253177 2:207781533-207781555 ACTCCAGGTAACGCTTCCCTGGG + Intergenic
946202616 2:218079705-218079727 ACTCCCGGGAAAGGAGCCCGTGG + Intronic
946483802 2:220081464-220081486 TCTCCAGGTAAAACATCCTCCGG - Intergenic
947821332 2:233073113-233073135 AACCTGGGTAAAGCAGCCCCCGG + Intronic
948813887 2:240499880-240499902 TCTCCAGGGATAACAGCCCCAGG + Intronic
1172523119 20:35582137-35582159 GCTCGAGGTGGAGCAGCCCCAGG - Intergenic
1175495842 20:59413587-59413609 GCTCCAGTTTCAGCAGCCCCAGG + Intergenic
1180179775 21:46112738-46112760 ACTCGAGGTGCAGCCGCCCCAGG + Intronic
1181344851 22:22211567-22211589 TCTCCAGGAAGAGCAGCCCTTGG - Intergenic
1183346404 22:37310768-37310790 ACGCCAGCTCAAGCAGCTCCAGG + Intronic
1184268857 22:43366080-43366102 ACACCAGGAAAGGCAGCCCTGGG + Intergenic
1185379738 22:50502920-50502942 CCTCCTGGGAAAGCAGCACCAGG + Intergenic
953220625 3:40968928-40968950 ACACCAGGTAAATCAGTCCATGG + Intergenic
955228947 3:57082246-57082268 CCTTCAGGGAAAGCAGCCGCAGG + Intergenic
955722945 3:61902954-61902976 AGGCCAAGTAAAGCAGCCCCTGG - Intronic
956671323 3:71693859-71693881 GCAGCAGGTAAAGCAGCCCACGG - Exonic
961392223 3:126558893-126558915 ACCACAGGAACAGCAGCCCCAGG + Exonic
962200808 3:133399948-133399970 ACAGCAGACAAAGCAGCCCCAGG + Intergenic
964837332 3:160953969-160953991 TTACAAGGTAAAGCAGCCCCAGG - Intronic
966587973 3:181648973-181648995 ACTCCAGGTAAAAAAGCACCTGG - Intergenic
967341776 3:188406439-188406461 ACTAAAAGTAAAGGAGCCCCCGG + Intronic
968433646 4:574549-574571 CCACCAGGCAGAGCAGCCCCAGG + Intergenic
972251582 4:37308532-37308554 ACCCCAGGTAAACCAGACCTTGG + Intronic
975405310 4:73981899-73981921 ACCCCAGGAACAGCAGCCCGGGG + Exonic
977233588 4:94480599-94480621 ACCCCTGGTCAATCAGCCCCTGG - Intronic
981985720 4:150852831-150852853 ACTTCAGTTCAAGCAGCCTCTGG - Exonic
985444746 4:190015640-190015662 CCCCCGGGTAAAGCAGCCCACGG - Intergenic
985637024 5:1040893-1040915 ACGGCAGGTAGAGCTGCCCCAGG - Intergenic
986165172 5:5266703-5266725 ACACCAGGAAGAGTAGCCCCAGG - Intronic
987188280 5:15446842-15446864 TCTCCAGATAAAGCAGCCTGGGG - Intergenic
992365674 5:76086616-76086638 AACCCAGGAAAGGCAGCCCCTGG + Intronic
993373719 5:87123286-87123308 ACTCCAGGACAAGTAGCCTCAGG - Intergenic
994853904 5:105091602-105091624 GCTCCAGGGCCAGCAGCCCCTGG + Intergenic
997672355 5:135685895-135685917 ACTCCAGGTCAAAAATCCCCAGG - Intergenic
998589791 5:143464871-143464893 ACCCCAGGTCAAGTGGCCCCAGG - Intergenic
1001823136 5:174725145-174725167 ACTCCCGGGAAAGCAAGCCCAGG + Intronic
1002306431 5:178286506-178286528 GCCCCAGGGACAGCAGCCCCGGG + Intronic
1005968432 6:30743064-30743086 ACTCCAGGAAAAGGGGCTCCTGG + Intergenic
1007749136 6:44061311-44061333 ACTTCAGGAAAAGCATCCCTGGG - Intergenic
1012382639 6:98638666-98638688 ACTCCAGGAAAAGAAGAACCAGG - Intergenic
1013441776 6:110179163-110179185 TCTCCAGCGAGAGCAGCCCCGGG + Intronic
1014778174 6:125533995-125534017 AAGCCGGGGAAAGCAGCCCCGGG - Intergenic
1018172437 6:161153120-161153142 ACCCCAGGAAAAGCAGGCACAGG + Intronic
1021161304 7:17276177-17276199 TCTCCAAGTAAAGCAGCCAAGGG - Intergenic
1027167024 7:75842107-75842129 AATCCAGGTTTAGCAGCCCTGGG + Intergenic
1032613953 7:133445720-133445742 ACACCAGATAACGCAGCTCCTGG - Intronic
1034877459 7:154738216-154738238 CCTCCAGGTATAGCATCTCCAGG + Intronic
1036623597 8:10445902-10445924 ACGCCAGGGAAAGCAGGCCAGGG - Intergenic
1037578552 8:20230794-20230816 GCTCCAGGGAAAGCAGCCCTGGG + Intergenic
1038911327 8:31967928-31967950 AATACTGGTACAGCAGCCCCAGG + Intronic
1041889548 8:62853643-62853665 TCTCCAGGAAAAGCAGCTCCTGG + Intronic
1046335462 8:112781020-112781042 ACTCCAGGCAATGCAGCTCCAGG + Intronic
1049298518 8:141856534-141856556 CCTCCAGGTCCAGCAGCCTCTGG - Intergenic
1054457128 9:65438809-65438831 ACCCCAGGTAAAGCTTCCCTAGG - Intergenic
1055069987 9:72156339-72156361 ACTTCTGGTAAAGTAGCCTCAGG - Intronic
1055602248 9:77931838-77931860 AATCCAAGTAAAGCAGTACCTGG + Intronic
1056846271 9:90040615-90040637 ACTCCCTGAAAAGCTGCCCCTGG + Intergenic
1056902545 9:90613320-90613342 TCTCCAGGTTGAGCAGCTCCTGG + Exonic
1058721494 9:107768554-107768576 AATCCAGGTTAAGGACCCCCTGG - Intergenic
1059942141 9:119369040-119369062 ACTCCAGGTAAGGCGGCGCCGGG - Exonic
1061139434 9:128755588-128755610 ACTCCAGGACAAGGATCCCCAGG + Exonic
1061473545 9:130846667-130846689 CCTCCAGGAAAAACATCCCCGGG - Intronic
1062269983 9:135703940-135703962 ACTGCAGGCAGAGCAGCCGCCGG + Intronic
1062370568 9:136236727-136236749 GCTCCAGGTGACGCAGACCCAGG - Intronic
1062370750 9:136237408-136237430 GCTCCAGGTGATGCAGGCCCAGG - Intronic
1203760324 EBV:9707-9729 GTGCCAGGTAAAGCAGCACCAGG - Intergenic
1185708846 X:2286195-2286217 AATCCAGGTACATCAGACCCAGG + Intronic
1186286954 X:8055269-8055291 ACTCCAGGGAAAGCAGCTTGGGG + Intergenic
1187269762 X:17769100-17769122 GCTGCAGGTGAAGCAGCCACTGG - Intergenic
1189333678 X:40157357-40157379 GCTCCAGTTTAGGCAGCCCCCGG - Intronic
1189592066 X:42524076-42524098 ACTCCATGAAAAGCAGCATCAGG - Intergenic
1190394864 X:49971633-49971655 ACTCCAGGTGCAGCAGGCCAAGG - Intronic
1190537968 X:51447959-51447981 TCTCCAGGTAATGCAGCTGCAGG - Intergenic
1193726561 X:85047006-85047028 ACTCTAGGTAAAGGAGCCTAAGG + Intronic
1195708624 X:107756836-107756858 ACTCCAGCTGATGCAGCCCCTGG - Intronic
1195802681 X:108731635-108731657 ATTCCAGGGTAAGCTGCCCCTGG + Intronic
1198159386 X:133991718-133991740 ACTGCAAGTCAGGCAGCCCCTGG - Intergenic
1198372935 X:136008977-136008999 AATCCAGGGAAAGCAACCTCAGG + Intronic
1200060533 X:153481844-153481866 ACTCCAGGTTGGGCAGCCCCAGG - Intronic
1200153789 X:153964562-153964584 ACTCCAGGTAAAGCAGCCCCAGG - Exonic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1200421279 Y:2971400-2971422 ACTACAGGTAAAGCAAAACCAGG - Intronic