ID: 1200154891

View in Genome Browser
Species Human (GRCh38)
Location X:153970177-153970199
Sequence GGAGCTCTGCCTGCGCCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200154891 Original CRISPR GGAGCTCTGCCTGCGCCAAG GGG Intronic
900100389 1:959932-959954 GGAGCCGTGCCTGCGCCCCGCGG - Intergenic
900284888 1:1894338-1894360 GGATTTCTGCCTGGGCCATGGGG - Intergenic
900718510 1:4160275-4160297 AGAGCCCTGCCTGCGCCATGGGG - Intergenic
901626659 1:10628800-10628822 CCATCTCTGCCTGAGCCAAGAGG - Intronic
901669731 1:10849257-10849279 GGAGCTCTGCCTGGTCCGGGTGG - Intergenic
904443260 1:30546394-30546416 CAAACTCTGCCTGGGCCAAGGGG - Intergenic
904602910 1:31683603-31683625 AGGGCTCTGCCTGCCCCCAGAGG - Intronic
904624656 1:31795642-31795664 GAACCTCTACCTGTGCCAAGAGG - Intronic
909009132 1:70313437-70313459 GGAGGACTGCCTGAGCCCAGGGG + Intronic
910122495 1:83805915-83805937 GGAGGTCTGCCTGCGCTGATAGG - Intergenic
911552948 1:99306367-99306389 GCAGCTCTGCTCGGGCCAAGTGG + Exonic
913146132 1:115992087-115992109 GGAGCTCTGCCAGGTCCCAGTGG - Exonic
916401479 1:164453624-164453646 GGAGGACTGCCTGAGCCCAGTGG + Intergenic
917748573 1:178034617-178034639 AGAGCACTGCCTGAGCCCAGGGG + Intergenic
922109571 1:222543874-222543896 GCAGCTCTGCCTGAGCGAGGTGG - Exonic
922832446 1:228610559-228610581 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
922833006 1:228612800-228612822 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
922833567 1:228615041-228615063 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
922834126 1:228617282-228617304 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
922834684 1:228619523-228619545 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
922835235 1:228621738-228621760 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
922835794 1:228623958-228623980 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
922836353 1:228626200-228626222 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
922836911 1:228628439-228628461 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
922837470 1:228630681-228630703 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
922838031 1:228632922-228632944 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
922838589 1:228635162-228635184 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
922839147 1:228637387-228637409 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
922839707 1:228639628-228639650 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
922840268 1:228641859-228641881 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
922840828 1:228644100-228644122 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
922841391 1:228646331-228646353 GGAGCACTCCCTGCTCCGAGCGG - Intergenic
1066415382 10:35216484-35216506 AGTGCTCACCCTGCGCCAAGGGG + Intergenic
1070151640 10:73808666-73808688 GGCGCTCAGCCAGGGCCAAGGGG - Exonic
1070166666 10:73903855-73903877 GGAGGACTGCTTGAGCCAAGGGG + Intergenic
1072420979 10:95290627-95290649 GGAGCGCAGCCTCCGCGAAGGGG + Intronic
1072523992 10:96255222-96255244 CGAGCTCTTCCAGGGCCAAGAGG + Intronic
1075468938 10:122673394-122673416 GGAGCTCTGCATCTGCCCAGCGG + Intergenic
1075580637 10:123615351-123615373 GGATCTCTGCCTGAGCCCAGGGG - Intergenic
1076785214 10:132746114-132746136 AGCGCCCTGCCTGGGCCAAGTGG - Intronic
1076804974 10:132850969-132850991 GGAGCTCCCCCTGCTGCAAGAGG + Intronic
1077415360 11:2422110-2422132 GGAGCGCTGCCTGTGCCGGGTGG + Intronic
1078546887 11:12253276-12253298 GCAGCTCTGCCTGGGCCCTGGGG - Intronic
1081716265 11:45252564-45252586 GGAGCTCCTCCTCCGCCAGGGGG + Exonic
1081752137 11:45518785-45518807 AGGGCCCTGCCTGGGCCAAGAGG - Intergenic
1081776650 11:45680329-45680351 GGACCCCTGCCTTGGCCAAGGGG - Intergenic
1083632773 11:64104284-64104306 GGAGCTCTGGCTGGGAAAAGGGG - Intronic
1084091701 11:66883061-66883083 GGAGCGCCGGCTGCTCCAAGTGG + Intronic
1084124606 11:67090865-67090887 GGAGGACTGCCTGAGCCAGGAGG + Intergenic
1084659516 11:70538688-70538710 GGGGCTCTGCCTGCTCCAGGGGG + Intronic
1089143319 11:116305731-116305753 GCAGCTCTGCCTACACCATGTGG + Intergenic
1089334139 11:117711175-117711197 TGAGCTCAGCCTGCCCCATGAGG - Intronic
1089400694 11:118162686-118162708 GGAGATCTGGCAGCGCCAATGGG + Exonic
1090263868 11:125342030-125342052 TGAGCTCTGCCTGGGCCACCAGG + Intronic
1092011262 12:5114570-5114592 GCAGCTCTGCCTGCACCACTTGG + Intergenic
1096744473 12:53716406-53716428 GGAGCTCAGCCTGAGGGAAGTGG + Exonic
1096759923 12:53832723-53832745 GGAGCTATGACTGCCCCCAGGGG - Intergenic
1098071349 12:66679040-66679062 GGACCTCTGCATCAGCCAAGAGG - Intronic
1099573602 12:84356267-84356289 GGCGCCCTGCCTGCGCCTAGAGG - Intergenic
1104923019 12:132300897-132300919 GGGGCTCTGCCCTCTCCAAGGGG - Intronic
1106571521 13:30932584-30932606 GGAGTTCTGCCCCTGCCAAGGGG - Intergenic
1107671743 13:42753387-42753409 AGAGCTCAGCCTGAGCAAAGAGG - Intergenic
1108574761 13:51781669-51781691 GGAGCACAGCCTGTGCAAAGAGG + Intronic
1110422271 13:75326211-75326233 GGAGCTCTGCCTCAGCAGAGGGG + Exonic
1110538312 13:76678451-76678473 GGAGCTGAGCCTGAGCCAAAAGG - Intergenic
1111300298 13:86341102-86341124 GGAGCACTGCTTGAGCCCAGTGG - Intergenic
1113459682 13:110473057-110473079 GGAGCTCAGCCCGGGCCACGGGG + Exonic
1113584970 13:111458760-111458782 GCAGCTCTGCCTGTGCCAATGGG - Intergenic
1117108930 14:52428445-52428467 GGATCTCTGCCTGGGCCATTAGG + Intergenic
1119346807 14:73932094-73932116 GTACCTCAGCCTGGGCCAAGGGG - Exonic
1121723502 14:96129196-96129218 GGGGCTCTGCCACCCCCAAGGGG - Intergenic
1202835842 14_GL000009v2_random:76892-76914 AGAGCTCAGGCTGCACCAAGGGG - Intergenic
1123500632 15:20878121-20878143 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1124695153 15:31858179-31858201 GGCTCTCTCCCTGCTCCAAGAGG - Intronic
1125499731 15:40232145-40232167 TGAGCTCTGCCTCCTGCAAGGGG - Intergenic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1128145993 15:65332811-65332833 GCAGCTCTGCCTGCGCAGTGAGG + Intronic
1128688369 15:69704348-69704370 AGAGCTCTGCCAAGGCCAAGAGG - Intergenic
1130130399 15:81136342-81136364 GGAGCTTTGCCTTGGCAAAGGGG + Intronic
1202966228 15_KI270727v1_random:178986-179008 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1132871952 16:2119305-2119327 ACAGCTCTGCCAGCGCCGAGAGG + Exonic
1133257589 16:4526828-4526850 GCAGCTCTGCCTGCGACACAGGG - Intronic
1133564787 16:6983227-6983249 GTAGCTCTGCCATCACCAAGAGG - Intronic
1134520574 16:14917591-14917613 ACAGCTCTGCCAGCGCCGAGAGG - Intronic
1134551000 16:15138383-15138405 ACAGCTCTGCCAGCGCCGAGAGG + Intronic
1134708246 16:16316242-16316264 ACAGCTCTGCCAGCGCCGAGAGG - Intergenic
1134951356 16:18352403-18352425 ACAGCTCTGCCAGCGCCGAGAGG + Intergenic
1134959296 16:18395884-18395906 ACAGCTCTGCCAGCGCCGAGAGG + Intergenic
1139597080 16:67964272-67964294 GGAGGTTTGCCTGGGGCAAGCGG - Intronic
1139634326 16:68248760-68248782 GGAGCTCTGCCTGGGAGGAGGGG - Intronic
1141398477 16:83725494-83725516 GGATCTCTGCCGGGGGCAAGCGG + Intronic
1142305852 16:89285030-89285052 GGAGCTCTGGCTGCCTCAAGGGG - Exonic
1144788050 17:17842682-17842704 GGAACTGTGCCTTCTCCAAGTGG - Intergenic
1144835322 17:18153875-18153897 GAAGATCTTCCTGCGCAAAGAGG + Exonic
1147158999 17:38559886-38559908 GTGGCTCTACCTGCCCCAAGTGG + Intronic
1147786311 17:42980888-42980910 GCAGTTCCGCCTGCGCCAGGTGG + Exonic
1148998615 17:51734317-51734339 GTAGCTCTTCCAGCACCAAGAGG - Intronic
1149599194 17:57882274-57882296 GGAACTCTGCCTGGGCCCATAGG - Intronic
1151946122 17:77320926-77320948 GGGTCTGTGCCTGCGGCAAGGGG - Intronic
1153044059 18:839500-839522 GGAGCTCTGCGGGCGCCACCTGG + Intergenic
1161065310 19:2234616-2234638 GGAGGACTGCTTGAGCCAAGGGG + Intronic
1161107866 19:2453519-2453541 GGAGTTCCGCCTGCGACTAGTGG - Intronic
1161173310 19:2824201-2824223 AGAGCCCTGCCTCCTCCAAGTGG - Intronic
1163641460 19:18464759-18464781 GGAGCTCTGCCTGGACTAAGAGG + Intronic
1164702213 19:30293792-30293814 GCAGCGCTGCCTGAGCCAAGGGG + Intronic
1164776088 19:30854840-30854862 GGGGGTCTGCCTGGGCCGAGTGG - Intergenic
1165054637 19:33166684-33166706 GGAGGTCTGCTTGAGCCCAGGGG + Intronic
1165812103 19:38617907-38617929 TGAGCTGGGCCTGCGCCCAGGGG + Exonic
1166393139 19:42421245-42421267 GGAGCTCAGCCAGGGCCAGGAGG - Intronic
1167467235 19:49656741-49656763 GGAGCTGTGCCTGTTCCAAGGGG - Intronic
1167489966 19:49786879-49786901 GGTGCTCTGCCAGGGTCAAGGGG + Intronic
1168335893 19:55597605-55597627 GCTGCTCTGCCTGCCCCAAGGGG - Exonic
1168691471 19:58380242-58380264 GGAGCTGTGCCTGCACTCAGAGG - Intronic
1202636795 1_KI270706v1_random:50471-50493 AGAGCTCAGGCTGCACCAAGGGG + Intergenic
925871120 2:8271612-8271634 GGAACTCTGCCTCAGCCAAGAGG + Intergenic
926134373 2:10326255-10326277 GGAGATCTCCCTGCCTCAAGGGG + Intronic
927090220 2:19704914-19704936 GCAGCTCTGCCTGTCCTAAGAGG + Intergenic
928112542 2:28522308-28522330 GGAGCTCTGCCTGCTTTCAGTGG - Intronic
928607350 2:32954872-32954894 GCAGCTCTGGCTGCTCCAGGGGG + Intronic
937454785 2:122031866-122031888 GGAGTACTGCCTGGGCAAAGGGG + Intergenic
937976711 2:127586890-127586912 GGAGCTCTGCCTGAGCCTCAGGG + Intronic
947426281 2:229985821-229985843 GGAGGACTGCCTGAGCCCAGGGG + Intronic
947951821 2:234154439-234154461 GGAGCATTGCCTGAGCCCAGAGG - Intergenic
948429573 2:237911261-237911283 GCAGCTCTGTCTGCACCAGGAGG - Intronic
948795959 2:240402216-240402238 GGAGCTCAGCCTGCGGGGAGGGG - Intergenic
948854534 2:240723993-240724015 CGAGCTCAGCCTGTGCCACGTGG - Exonic
1172182757 20:33013689-33013711 GGGGGCCTGCCTGGGCCAAGTGG + Intronic
1173614292 20:44392852-44392874 GGAGCTCTGCCTGCCCAGAGTGG - Intronic
1176258907 20:64168749-64168771 GGAGCACGGCCTGTGCCAGGAGG + Intronic
1179057274 21:37947562-37947584 GGTGCACTGCCTGGGCAAAGGGG + Intergenic
1179422529 21:41248163-41248185 GGCGCTGGGCCTGAGCCAAGCGG - Intronic
1179596886 21:42448828-42448850 GGATCTCTGCCTGCAGCATGAGG - Intergenic
1180364076 22:11923842-11923864 AGAGCTCAGGCTGCACCAAGGGG - Intergenic
1181031320 22:20149975-20149997 GGAGCTGTGCCAGGGGCAAGAGG - Exonic
1183368723 22:37420331-37420353 CCAGGTCTGCCTCCGCCAAGTGG + Intronic
1183673784 22:39288796-39288818 GGAGCTCTGCCTGGTACCAGCGG + Intergenic
1183729488 22:39609888-39609910 GGAGCTCTGCCTGTGCTGACTGG + Intronic
1183746296 22:39693979-39694001 GGGGCTCTGCCTGGGCAGAGCGG + Intergenic
1184296084 22:43526447-43526469 GGAGCTCAGCCTCTGCCCAGGGG + Intergenic
1184313147 22:43661680-43661702 TGAGCTCTGCCTCCACCAGGAGG + Intronic
1184510049 22:44928129-44928151 GGAGCTCTGCCAGGGCAGAGGGG + Intronic
1184859068 22:47163051-47163073 GGAGCTGGGCCTGGGCCAGGTGG + Intronic
1184875721 22:47274235-47274257 GGAGCCCTGGCTTCGCCAACAGG - Intergenic
1185213084 22:49582975-49582997 GGGGCTCTGCCTCTGCCCAGTGG - Intronic
950440338 3:13006748-13006770 GAAGCACTGCCTGGGCCCAGGGG + Intronic
950882851 3:16337111-16337133 GGAACCCTGCCTACGCCATGAGG + Intronic
952855964 3:37771063-37771085 GGACCTCTGCCAGCTCCCAGAGG + Intronic
953386291 3:42507921-42507943 AGAGCTCAGCCTTCCCCAAGAGG + Intronic
960961557 3:123073816-123073838 AGAAATCTGCCTGCGCCAAGGGG - Intronic
963531301 3:146476285-146476307 GGAGCTCCCCCTGCCCCATGTGG - Intronic
963777293 3:149452120-149452142 GGGGCTCTGCCTATGCCTAGTGG - Intergenic
969292919 4:6252227-6252249 GGAGCTCTGCCTGGGGCAGGAGG - Intergenic
971365185 4:25971470-25971492 GGAGCTCTGCCTGTGCCATGGGG - Intergenic
971456535 4:26850455-26850477 GGAGGACTGCCTGAACCAAGAGG + Intergenic
971469798 4:27010521-27010543 AGAGCTCTGCCTCCACCCAGTGG + Intronic
973394007 4:49578594-49578616 GGAGCTCAGGCTGCACCAAGGGG - Intergenic
977637911 4:99321988-99322010 TGACCTCTGCCTGTGCCAAGAGG + Intergenic
978822317 4:112980069-112980091 GCAGCTCTGCCTGGGCCTAAAGG - Intronic
978963044 4:114707620-114707642 GGAGCTCTCCCTGAGAAAAGAGG + Intergenic
980531523 4:134062121-134062143 GGAACTCTGCCTGTGTCAAAGGG + Intergenic
981400100 4:144303660-144303682 GGAGCTGTGCCTGCCAAAAGTGG + Intergenic
1202764110 4_GL000008v2_random:136342-136364 AGAGCTCAGGCTGCACCAAGGGG + Intergenic
986107141 5:4670767-4670789 GAGGCTCTGCGTGCACCAAGGGG + Intergenic
990097666 5:52137075-52137097 GGAGCTCTTCATGCGCAAATGGG + Intergenic
992521692 5:77558524-77558546 TGACCTCAGCCTGCCCCAAGAGG - Intronic
997367246 5:133333915-133333937 GGACCCCAGCCTGAGCCAAGAGG + Intronic
999330739 5:150671968-150671990 GGTGCTCTTCCTGCCCCATGGGG - Intronic
1002342732 5:178527432-178527454 GGGGCTCTGCCAGCTCCAAGGGG + Intronic
1010560535 6:77343469-77343491 GGGCGTCTGCCTGCTCCAAGAGG - Intergenic
1012548398 6:100447124-100447146 CGAGTGCTGGCTGCGCCAAGAGG - Intronic
1012939570 6:105402820-105402842 GTATCTCTGCCTCCGCCCAGAGG - Intronic
1019164497 6:170088901-170088923 GCAGAGCTGCCTGCACCAAGTGG - Intergenic
1019545027 7:1570031-1570053 GTGGCTCTGCGTGCGCCACGCGG + Intronic
1019606437 7:1912522-1912544 GCAGCCCTGCCTGTGCCAGGAGG - Intronic
1024107875 7:46110876-46110898 GGAACTCTGCCAGCTCCAACAGG + Intergenic
1024409964 7:49029027-49029049 TGACCTCTGCCTGTGCCATGTGG - Intergenic
1024948152 7:54832976-54832998 GGAGCCCTGCCTGCTCCATCTGG + Intergenic
1027164556 7:75825259-75825281 GGAGCTGTGCCTGGACCATGAGG - Intergenic
1031452604 7:121940313-121940335 GGAGCTTTACCTACTCCAAGAGG + Intronic
1033079157 7:138278903-138278925 GGAGCTCTGTCTGAGGAAAGGGG - Intergenic
1034489413 7:151385412-151385434 GGAGCACTGGCTGCCCCATGGGG - Intronic
1034564430 7:151901838-151901860 GGGGCTCTGGATGCCCCAAGAGG + Intergenic
1034936589 7:155204149-155204171 GGCGCTCTGCCTCCAGCAAGAGG + Intergenic
1037716954 8:21408817-21408839 GGGGCTCTGCCTGGGGCAGGAGG - Intergenic
1038426490 8:27467437-27467459 GGAGCCCTGGCTGCTCCAAGGGG - Intronic
1043868544 8:85402982-85403004 AGTGCTCTGCATGAGCCAAGAGG + Intronic
1046573231 8:115992892-115992914 GAAACTCTGTCTGCACCAAGAGG + Intergenic
1049473350 8:142785958-142785980 GGAGCTCTGCGACTGCCAAGAGG + Intronic
1050365678 9:4871442-4871464 GGGGATCTGCATGCCCCAAGAGG + Intronic
1053363672 9:37507897-37507919 GGAGCTCAGGCTGCACCAGGAGG + Intergenic
1057203422 9:93156169-93156191 GGACCGCTGCCTGCGCAGAGGGG + Intergenic
1059004292 9:110384274-110384296 GGAGCTCTGCTTGCCCCATGTGG + Intronic
1061871285 9:133522140-133522162 GCAGCACTGCCTGCCCAAAGAGG + Intronic
1203792543 EBV:159597-159619 GGAGCAGTACCTGCGCCAGGTGG - Intergenic
1203544857 Un_KI270743v1:121215-121237 AGAGCTCAGGCTGCACCAAGGGG + Intergenic
1187697046 X:21933294-21933316 GCAGCTCTGCCTGGGCCAGGGGG + Intergenic
1193636965 X:83962922-83962944 AGAGCTGTGGCTGCTCCAAGAGG + Intergenic
1197260636 X:124313312-124313334 GGAGCACTGCCTGTCCCAAATGG - Intronic
1197424108 X:126273462-126273484 GGAGCTCTGCTTGCCCCATGTGG + Intergenic
1200154891 X:153970177-153970199 GGAGCTCTGCCTGCGCCAAGGGG + Intronic
1200301756 X:154983645-154983667 AGAGCCCTGCCTGTCCCAAGTGG + Intronic