ID: 1200154893

View in Genome Browser
Species Human (GRCh38)
Location X:153970192-153970214
Sequence GGCGGGCGGATGTGTCCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200154893_1200154900 1 Left 1200154893 X:153970192-153970214 CCAAGGGGACACATCCGCCCGCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1200154900 X:153970216-153970238 CAGCCCCAGCCCCAGCCCGCTGG 0: 1
1: 3
2: 28
3: 163
4: 1013
1200154893_1200154910 14 Left 1200154893 X:153970192-153970214 CCAAGGGGACACATCCGCCCGCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1200154893_1200154901 2 Left 1200154893 X:153970192-153970214 CCAAGGGGACACATCCGCCCGCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1200154901 X:153970217-153970239 AGCCCCAGCCCCAGCCCGCTGGG 0: 1
1: 0
2: 13
3: 93
4: 553
1200154893_1200154905 8 Left 1200154893 X:153970192-153970214 CCAAGGGGACACATCCGCCCGCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1200154905 X:153970223-153970245 AGCCCCAGCCCGCTGGGTAACGG 0: 1
1: 0
2: 1
3: 21
4: 135
1200154893_1200154909 13 Left 1200154893 X:153970192-153970214 CCAAGGGGACACATCCGCCCGCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1200154909 X:153970228-153970250 CAGCCCGCTGGGTAACGGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200154893 Original CRISPR GGCGGGCGGATGTGTCCCCT TGG (reversed) Intronic
900484155 1:2913623-2913645 GGAAGGCGGTGGTGTCCCCTTGG - Intergenic
900488018 1:2932712-2932734 GACAGGCAGCTGTGTCCCCTTGG + Intergenic
900955911 1:5886378-5886400 GTCGGGTGGATGTGGCCCATGGG + Intronic
907364239 1:53946192-53946214 CGCGGGAGGGTGGGTCCCCTGGG - Exonic
914508622 1:148310420-148310442 AGCGCGCGGATGAGGCCCCTTGG - Intergenic
919643888 1:200072977-200072999 GGCAGGCTGATGTTTCCTCTAGG + Intronic
1065773777 10:29101189-29101211 GGAGGGGGCAGGTGTCCCCTGGG + Intergenic
1066351984 10:34644231-34644253 GCAGGGCAGATGTCTCCCCTGGG - Intronic
1071579581 10:86756891-86756913 GGCTGGAGGATGCGTTCCCTGGG + Exonic
1077062988 11:625927-625949 GGAGGGTGGAGGTGTCACCTGGG - Intronic
1089835015 11:121363039-121363061 GGCTGGAGGATGCGTTCCCTGGG - Intergenic
1091301219 11:134509484-134509506 GGCGGGCAGATGTCTTACCTGGG + Intergenic
1092213424 12:6663269-6663291 GTCGGGCGGATGTGTACCGGCGG - Intergenic
1105745749 13:23375597-23375619 GGCGGGTGGGCGTGTCCCCGCGG - Intronic
1108389715 13:49936272-49936294 GGCGGGGGGCAGTGTCGCCTCGG - Exonic
1113905438 13:113817324-113817346 GGAGGGGGGATGTGTCCCGTGGG - Intergenic
1113905450 13:113817348-113817370 GGAGGGGGGATGTGTCCCGTGGG - Intergenic
1117899163 14:60515215-60515237 GGCGGGCGCGTGGGTCCCCTCGG + Intronic
1129326590 15:74803156-74803178 GGCGGGCGGCGGTGTCCTCATGG - Exonic
1129344212 15:74906526-74906548 GGCGGGCGGCCGCGTCCCCAGGG - Intronic
1131056636 15:89378903-89378925 GGCCCGCGGCTGTTTCCCCTCGG + Intergenic
1133194518 16:4159472-4159494 GGTGGGCGATTCTGTCCCCTCGG - Intergenic
1137439591 16:48486496-48486518 GGCAGGTGGATGTGTCATCTTGG + Intergenic
1137610416 16:49813882-49813904 GGGGGGCGGATGTGGACCCCTGG - Intronic
1137738464 16:50742246-50742268 GGCGGGCGGCCGGATCCCCTCGG + Intronic
1149693712 17:58599833-58599855 TGAGGGAGTATGTGTCCCCTAGG + Intronic
1152208986 17:78992998-78993020 TGTGGGCAGATGTGTCCCCAGGG + Exonic
1153222606 18:2875039-2875061 GGCTGGAGGATGTGGCACCTGGG + Intronic
1157515860 18:48310869-48310891 GGCCAGCTGATGTGTCTCCTTGG - Intronic
1160452208 18:78973694-78973716 GGCGGTGGGCTGTGTCCCCGCGG - Intergenic
1160789604 19:917426-917448 GTCGGGCGGAGGGGTCCCCGGGG + Exonic
1160792291 19:928294-928316 GGCGGGTGGAGGTGTGGCCTGGG + Intronic
1163366714 19:16879664-16879686 GGTGGGCGGATGGGGCTCCTTGG - Exonic
1163698804 19:18777067-18777089 GCCGGGCGACTCTGTCCCCTGGG - Intronic
1167233177 19:48297880-48297902 GGCTGGCGGATGTGGCCCTGGGG - Intronic
1168272250 19:55256454-55256476 TGGGGGCGATTGTGTCCCCTGGG - Intronic
925626030 2:5842611-5842633 GCCGGGCAGATGTGTCCTCCGGG + Intergenic
938699050 2:133860009-133860031 GGCTGACTGAGGTGTCCCCTGGG - Intergenic
941770736 2:169343048-169343070 GGAGGTCAGATGTGTCCTCTGGG - Intronic
947276921 2:228401996-228402018 GGCAGGGGGATCTGCCCCCTAGG - Intergenic
948365109 2:237449710-237449732 GGCAGGACGATGTGTTCCCTTGG - Intergenic
1171094117 20:22315377-22315399 GGGGGAAGGATGTTTCCCCTAGG - Intergenic
1172888162 20:38245758-38245780 GGGGGGCTGATGTCTCCCCCTGG + Intronic
1173227770 20:41171964-41171986 GGAGGGCAAATGTGTCCTCTGGG + Intronic
1175938300 20:62525315-62525337 GCCGGGAGGATCTGGCCCCTGGG - Intergenic
1176046894 20:63097435-63097457 GGCGGGCGGATGTGCGTCCAGGG - Intergenic
1179645934 21:42776140-42776162 GGCTGCTGGCTGTGTCCCCTGGG + Intergenic
1180188098 21:46150332-46150354 GGCGAGCCGATCTGTCCCGTGGG - Intronic
1182297099 22:29316017-29316039 GGGGGGCGGCTGTGTGACCTTGG + Intronic
1185342968 22:50299787-50299809 GGCGGGGGGCGGTGTCTCCTGGG + Intronic
949874617 3:8618179-8618201 GGCAGGACGAGGTGTCCCCTTGG - Intergenic
956877633 3:73479464-73479486 GGCTGGTGGATGACTCCCCTCGG - Intronic
969293125 4:6253141-6253163 GGAGGGCTGCAGTGTCCCCTAGG + Intergenic
972817063 4:42656671-42656693 CGCGGGGGGAAGGGTCCCCTAGG + Intronic
976952186 4:90847332-90847354 GGCCTGCGGCAGTGTCCCCTTGG + Intronic
982233750 4:153232947-153232969 GCCGGGTGGAGCTGTCCCCTGGG + Intronic
984713279 4:182903673-182903695 GGCAGGCGGATGGGCACCCTGGG - Intronic
1002608664 5:180399403-180399425 GGAGGCCGGAAGTGTCACCTGGG + Intergenic
1004409741 6:15369916-15369938 GGAGGAAGGATGTCTCCCCTAGG + Intronic
1006047348 6:31308702-31308724 GGAGGGAGGCTGTGTCCCCGCGG - Intronic
1006785618 6:36664902-36664924 GGGGGGCAGATGTGACACCTGGG - Intergenic
1019342888 7:516945-516967 GGCGGGCGGAGGCGGCCCCCGGG - Intronic
1026906095 7:74063534-74063556 GGAGGGCGGAGGTGTCCTCTGGG - Intronic
1033600530 7:142885577-142885599 GGGGGGCTGATGTGGCCCCAAGG - Exonic
1035175448 7:157046787-157046809 GGAGGGTGGATGGGTCCCTTTGG - Intergenic
1036208993 8:6826891-6826913 GGTGAGCAGATGTGTCCCCGTGG - Intronic
1039379011 8:37067535-37067557 AGCGGGCTGATGTGTGCCCCTGG - Intergenic
1045021109 8:98045267-98045289 GGCGGGCAGATGTGAGCCCACGG - Intronic
1047870532 8:129077272-129077294 GGCAGGCGGCTGTGTACTCTGGG + Intergenic
1049203382 8:141352341-141352363 GGTGGGCGGATGTGGCCACGTGG + Intergenic
1052348856 9:27437736-27437758 GGCAGGCAGATGTGTCCCTGTGG - Intronic
1057921052 9:99097153-99097175 GGCCGGAGGATGTGTCTCCAGGG + Intergenic
1058853594 9:109037490-109037512 GGCGGGTGGATTTCACCCCTAGG + Intronic
1061506209 9:131033346-131033368 AGCGGGCTGATGTGTTCACTGGG - Intronic
1185621450 X:1453327-1453349 GGCGGGCGGGGGTGTGGCCTGGG - Intronic
1200000177 X:153056226-153056248 GGCGGGCGCTTGTGTGCCCGGGG + Intergenic
1200154893 X:153970192-153970214 GGCGGGCGGATGTGTCCCCTTGG - Intronic