ID: 1200154895

View in Genome Browser
Species Human (GRCh38)
Location X:153970209-153970231
Sequence GCTGGGGCTGGGGCTGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7603
Summary {0: 188, 1: 236, 2: 392, 3: 1492, 4: 5295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200154895_1200154910 -3 Left 1200154895 X:153970209-153970231 CCCGCCCCAGCCCCAGCCCCAGC 0: 188
1: 236
2: 392
3: 1492
4: 5295
Right 1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1200154895_1200154905 -9 Left 1200154895 X:153970209-153970231 CCCGCCCCAGCCCCAGCCCCAGC 0: 188
1: 236
2: 392
3: 1492
4: 5295
Right 1200154905 X:153970223-153970245 AGCCCCAGCCCGCTGGGTAACGG 0: 1
1: 0
2: 1
3: 21
4: 135
1200154895_1200154913 17 Left 1200154895 X:153970209-153970231 CCCGCCCCAGCCCCAGCCCCAGC 0: 188
1: 236
2: 392
3: 1492
4: 5295
Right 1200154913 X:153970249-153970271 GGGTCTGAAGTCACCACCGCTGG 0: 1
1: 0
2: 2
3: 6
4: 91
1200154895_1200154909 -4 Left 1200154895 X:153970209-153970231 CCCGCCCCAGCCCCAGCCCCAGC 0: 188
1: 236
2: 392
3: 1492
4: 5295
Right 1200154909 X:153970228-153970250 CAGCCCGCTGGGTAACGGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200154895 Original CRISPR GCTGGGGCTGGGGCTGGGGC GGG (reversed) Intronic
Too many off-targets to display for this crispr