ID: 1200154896

View in Genome Browser
Species Human (GRCh38)
Location X:153970210-153970232
Sequence GGCTGGGGCTGGGGCTGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5839
Summary {0: 11, 1: 37, 2: 137, 3: 1039, 4: 4615}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200154896_1200154909 -5 Left 1200154896 X:153970210-153970232 CCGCCCCAGCCCCAGCCCCAGCC 0: 11
1: 37
2: 137
3: 1039
4: 4615
Right 1200154909 X:153970228-153970250 CAGCCCGCTGGGTAACGGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 70
1200154896_1200154905 -10 Left 1200154896 X:153970210-153970232 CCGCCCCAGCCCCAGCCCCAGCC 0: 11
1: 37
2: 137
3: 1039
4: 4615
Right 1200154905 X:153970223-153970245 AGCCCCAGCCCGCTGGGTAACGG 0: 1
1: 0
2: 1
3: 21
4: 135
1200154896_1200154913 16 Left 1200154896 X:153970210-153970232 CCGCCCCAGCCCCAGCCCCAGCC 0: 11
1: 37
2: 137
3: 1039
4: 4615
Right 1200154913 X:153970249-153970271 GGGTCTGAAGTCACCACCGCTGG 0: 1
1: 0
2: 2
3: 6
4: 91
1200154896_1200154910 -4 Left 1200154896 X:153970210-153970232 CCGCCCCAGCCCCAGCCCCAGCC 0: 11
1: 37
2: 137
3: 1039
4: 4615
Right 1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200154896 Original CRISPR GGCTGGGGCTGGGGCTGGGG CGG (reversed) Intronic
Too many off-targets to display for this crispr