ID: 1200154897

View in Genome Browser
Species Human (GRCh38)
Location X:153970213-153970235
Sequence GCGGGCTGGGGCTGGGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4309
Summary {0: 3, 1: 26, 2: 317, 3: 701, 4: 3262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200154897_1200154910 -7 Left 1200154897 X:153970213-153970235 CCCCAGCCCCAGCCCCAGCCCGC 0: 3
1: 26
2: 317
3: 701
4: 3262
Right 1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1200154897_1200154913 13 Left 1200154897 X:153970213-153970235 CCCCAGCCCCAGCCCCAGCCCGC 0: 3
1: 26
2: 317
3: 701
4: 3262
Right 1200154913 X:153970249-153970271 GGGTCTGAAGTCACCACCGCTGG 0: 1
1: 0
2: 2
3: 6
4: 91
1200154897_1200154909 -8 Left 1200154897 X:153970213-153970235 CCCCAGCCCCAGCCCCAGCCCGC 0: 3
1: 26
2: 317
3: 701
4: 3262
Right 1200154909 X:153970228-153970250 CAGCCCGCTGGGTAACGGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200154897 Original CRISPR GCGGGCTGGGGCTGGGGCTG GGG (reversed) Intronic
Too many off-targets to display for this crispr