ID: 1200154898

View in Genome Browser
Species Human (GRCh38)
Location X:153970214-153970236
Sequence AGCGGGCTGGGGCTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2401
Summary {0: 1, 1: 5, 2: 91, 3: 499, 4: 1805}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200154898_1200154910 -8 Left 1200154898 X:153970214-153970236 CCCAGCCCCAGCCCCAGCCCGCT 0: 1
1: 5
2: 91
3: 499
4: 1805
Right 1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1200154898_1200154913 12 Left 1200154898 X:153970214-153970236 CCCAGCCCCAGCCCCAGCCCGCT 0: 1
1: 5
2: 91
3: 499
4: 1805
Right 1200154913 X:153970249-153970271 GGGTCTGAAGTCACCACCGCTGG 0: 1
1: 0
2: 2
3: 6
4: 91
1200154898_1200154909 -9 Left 1200154898 X:153970214-153970236 CCCAGCCCCAGCCCCAGCCCGCT 0: 1
1: 5
2: 91
3: 499
4: 1805
Right 1200154909 X:153970228-153970250 CAGCCCGCTGGGTAACGGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200154898 Original CRISPR AGCGGGCTGGGGCTGGGGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr